1. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8
-gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
tcatg-accttcatcgcgcgcacgagcgccg Protospacer
*.* ****** *********** *****
2. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
gttgcaccttcttcgcgcgaacgcgcgtca Protospacer
* .********.******* *******.*
3. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.767
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
atcgcgccttcctcgcgcgctcgcgcaacc Protospacer
. ***.************** *****. *.
4. spacer 3.1|2566275|34|NZ_CP040872|CRISPRCasFinder matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 8, identity: 0.765
aggctgggccgggcgcgagcccatgccctgcgag CRISPR spacer
ggcccgctccgggcgcgtgcccttgccctgcgcg Protospacer
.* *.* ********* **** ********* *
5. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
acggcaacttcctcgtgcgcacgcgcgagc Protospacer
. *** ********.*********** .
6. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
7. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
8. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
9. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
10. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
11. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
12. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
13. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
14. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
15. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
16. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
17. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
18. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
19. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
20. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
21. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
22. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
23. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
24. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
25. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
26. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
27. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
28. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
29. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
30. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
31. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
32. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
33. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
34. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
35. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
acggcaacttcctcgtgcgcacgcgcgagc Protospacer
. *** ********.*********** .
36. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa Protospacer
. . *********** ******* ****
37. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
cgcaaaccctcctcgcgcgcacgcgcctcc Protospacer
.*. ***.***************** .*.
38. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
cgcaaaccctcctcgcgcgcacgcgcctcc Protospacer
.*. ***.***************** .*.
39. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to KR080206 (Mycobacterium phage ShedlockHolmes, complete genome) position: , mismatch: 8, identity: 0.733
gacgcaccttcctcgcgcgcacgcgcgcct CRISPR spacer
gcttgaccttgctcgcgctcacgcgcgcac Protospacer
* . ***** ******* ********* .
40. spacer 3.1|2566275|34|NZ_CP040872|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.735
aggctgggccgggcgcgagcccatgccctgcgag CRISPR spacer
caccatggccaggcgccagcccatgccctgcgtc Protospacer
. * ****.***** ***************