Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040872 Agromyces sp. HY052 chromosome, complete genome 4 crisprs csa3,WYL,DinG,cas3,DEDDh,Cas9_archaeal 0 2 0 0

Results visualization

1. NZ_CP040872
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040872_1 81749-81849 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040872_2 2426965-2427053 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040872_3 2566249-2566334 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040872_4 2779551-2779628 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 620519-620548 6 0.8
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 556130-556159 6 0.8
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1477637-1477666 7 0.767
NZ_CP040872_3 3.1|2566275|34|NZ_CP040872|CRISPRCasFinder 2566275-2566308 34 NZ_CP045204 Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence 5001-5034 8 0.765
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 381915-381944 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 62217-62246 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 42009-42038 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP021027 Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence 80519-80548 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 90833-90862 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 121754-121783 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 130657-130686 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 64702-64731 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 99141-99170 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 92830-92859 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 121363-121392 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 86372-86401 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 86373-86402 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 86372-86401 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 103356-103385 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 31993-32022 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 121754-121783 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 99062-99091 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 86373-86402 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 99141-99170 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 99140-99169 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 121363-121392 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 91426-91455 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 99138-99167 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 92829-92858 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 99138-99167 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 99062-99091 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 88288-88317 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 96841-96870 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 92829-92858 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 356292-356321 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 78982-79011 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 412974-413003 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 264428-264457 8 0.733
NZ_CP040872_4 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder 2779575-2779604 30 KR080206 Mycobacterium phage ShedlockHolmes, complete genome 55896-55925 8 0.733
NZ_CP040872_3 3.1|2566275|34|NZ_CP040872|CRISPRCasFinder 2566275-2566308 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1353743-1353776 9 0.735

1. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8

-gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
tcatg-accttcatcgcgcgcacgagcgccg	Protospacer
  *.* ****** *********** ***** 

2. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
gttgcaccttcttcgcgcgaacgcgcgtca	Protospacer
* .********.******* *******.* 

3. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.767

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
atcgcgccttcctcgcgcgctcgcgcaacc	Protospacer
. ***.************** *****. *.

4. spacer 3.1|2566275|34|NZ_CP040872|CRISPRCasFinder matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 8, identity: 0.765

aggctgggccgggcgcgagcccatgccctgcgag	CRISPR spacer
ggcccgctccgggcgcgtgcccttgccctgcgcg	Protospacer
.* *.*  ********* **** ********* *

5. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
acggcaacttcctcgtgcgcacgcgcgagc	Protospacer
.  *** ********.***********  .

6. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

7. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

8. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

9. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

10. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

11. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

12. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

13. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

14. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

15. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

16. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

17. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

18. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

19. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

20. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

21. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

22. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

23. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

24. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

25. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

26. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

27. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

28. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

29. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

30. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

31. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

32. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

33. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

34. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

35. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
acggcaacttcctcgtgcgcacgcgcgagc	Protospacer
.  *** ********.***********  .

36. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
attccaccttcctcgggcgcacgggcgcaa	Protospacer
. . *********** ******* ****  

37. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
cgcaaaccctcctcgcgcgcacgcgcctcc	Protospacer
 .*. ***.***************** .*.

38. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
cgcaaaccctcctcgcgcgcacgcgcctcc	Protospacer
 .*. ***.***************** .*.

39. spacer 4.1|2779575|30|NZ_CP040872|CRISPRCasFinder matches to KR080206 (Mycobacterium phage ShedlockHolmes, complete genome) position: , mismatch: 8, identity: 0.733

gacgcaccttcctcgcgcgcacgcgcgcct	CRISPR spacer
gcttgaccttgctcgcgctcacgcgcgcac	Protospacer
* .  ***** ******* ********* .

40. spacer 3.1|2566275|34|NZ_CP040872|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.735

aggctgggccgggcgcgagcccatgccctgcgag	CRISPR spacer
caccatggccaggcgccagcccatgccctgcgtc	Protospacer
 . *  ****.***** ***************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage