Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP032907 Helicobacter pylori strain 24-A-EK1 chromosome, complete genome 7 crisprs cas3,cas14j 0 2 1 0

Results visualization

1. NZ_CP032907
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_1 761246-761396 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_2 766307-766457 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_3 771368-771518 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_4 776429-776579 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_5 1170271-1170470 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_6 1335459-1335550 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032907_7 1392897-1393024 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP032907_6 6.1|1335485|40|NZ_CP032907|CRISPRCasFinder 1335485-1335524 40 KX119178 Helicobacter phage Pt5303G genomic sequence 12743-12782 2 0.95
NZ_CP032907_5 5.2|1170360|28|NZ_CP032907|CRT 1170360-1170387 28 MK250029 Prevotella phage Lak-C1, complete genome 138940-138967 6 0.786
NZ_CP032907_5 5.2|1170360|28|NZ_CP032907|CRT 1170360-1170387 28 MK250019 Prevotella phage Lak-A2, complete genome 101721-101748 6 0.786

1. spacer 6.1|1335485|40|NZ_CP032907|CRISPRCasFinder matches to KX119178 (Helicobacter phage Pt5303G genomic sequence) position: , mismatch: 2, identity: 0.95

agcgctttctttggcttcgttaatggtagttatcgcttgc	CRISPR spacer
agcgctttctttagcttcgttaatgttagttatcgcttgc	Protospacer
************.************ **************

2. spacer 5.2|1170360|28|NZ_CP032907|CRT matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 6, identity: 0.786

gcgcccaatctgcttttaataacagtgc	CRISPR spacer
tcgccccatctgtttttaataacatatc	Protospacer
 ***** *****.***********   *

3. spacer 5.2|1170360|28|NZ_CP032907|CRT matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 6, identity: 0.786

gcgcccaatctgcttttaataacagtgc	CRISPR spacer
tcgccccatctgtttttaataacatatc	Protospacer
 ***** *****.***********   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 651334 : 715336 52 Helicobacter_phage(60.0%) protease,transposase,integrase attL 651161:651220|attR 712892:714526
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage