Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP032908 Helicobacter pylori strain 23-A-EK1 chromosome, complete genome 4 crisprs DEDDh,cas3 2 2 1 0

Results visualization

1. NZ_CP032908
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032908_1 757724-757874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032908_2 1160332-1160455 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032908_3 1181684-1181881 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032908_4 1431034-1431120 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP032908_4 4.1|1431058|39|NZ_CP032908|CRISPRCasFinder 1431058-1431096 39 NZ_CP032908.1 289184-289222 0 1.0
NZ_CP032908_2 2.2|1160411|20|NZ_CP032908|CRISPRCasFinder 1160411-1160430 20 NZ_CP032908.1 1160456-1160475 2 0.9

1. spacer 4.1|1431058|39|NZ_CP032908|CRISPRCasFinder matches to position: 289184-289222, mismatch: 0, identity: 1.0

cccactcttgttcgctctatccctagcgttttcagcttc	CRISPR spacer
cccactcttgttcgctctatccctagcgttttcagcttc	Protospacer
***************************************

2. spacer 2.2|1160411|20|NZ_CP032908|CRISPRCasFinder matches to position: 1160456-1160475, mismatch: 2, identity: 0.9

ccccttgatcagaaactctc	CRISPR spacer
cccattgaacagaaactctc	Protospacer
*** **** ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP032908_3 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder 1181828-1181854 27 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 362427-362453 5 0.815
NZ_CP032908_3 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder 1181828-1181854 27 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 115214-115240 5 0.815
NZ_CP032908_3 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder 1181828-1181854 27 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 129032-129058 5 0.815
NZ_CP032908_3 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder 1181828-1181854 27 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 8350-8376 5 0.815
NZ_CP032908_3 3.2|1181771|30|NZ_CP032908|CRISPRCasFinder 1181771-1181800 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 816052-816081 8 0.733

1. spacer 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 5, identity: 0.815

ggcaacgccagctttgataacgatact	CRISPR spacer
gtcagcgccagctttgatcacgatatc	Protospacer
* **.************* ******..

2. spacer 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 5, identity: 0.815

ggcaacgccagctttgataacgatact	CRISPR spacer
gtcagcgccagctttgatcacgatatc	Protospacer
* **.************* ******..

3. spacer 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 5, identity: 0.815

ggcaacgccagctttgataacgatact	CRISPR spacer
gtcagcgccagctttgatcacgatatc	Protospacer
* **.************* ******..

4. spacer 3.3|1181828|27|NZ_CP032908|CRISPRCasFinder matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 5, identity: 0.815

ggcaacgccagctttgataacgatact	CRISPR spacer
gtcagcgccagctttgatcacgatatc	Protospacer
* **.************* ******..

5. spacer 3.2|1181771|30|NZ_CP032908|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

agcgctcaatctgcttttaatcatagcgct	CRISPR spacer
cgcgctcaatctgcttttcaacatcaaggc	Protospacer
 ***************** * *** . * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 57925 : 68837 9 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage