Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP032898 Helicobacter pylori strain 479-C-EK2 chromosome, complete genome 4 crisprs cas4,cas3,DEDDh 1 2 0 0

Results visualization

1. NZ_CP032898
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032898_1 270430-270499 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032898_2 421297-421382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032898_3 582860-583057 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032898_4 1179658-1179801 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP032898_1 1.1|270454|22|NZ_CP032898|CRISPRCasFinder 270454-270475 22 NZ_CP032898.1 615865-615886 0 1.0
NZ_CP032898_1 1.1|270454|22|NZ_CP032898|CRISPRCasFinder 270454-270475 22 NZ_CP032898.1 270486-270507 1 0.955
NZ_CP032898_1 1.1|270454|22|NZ_CP032898|CRISPRCasFinder 270454-270475 22 NZ_CP032898.1 615897-615918 1 0.955
NZ_CP032898_1 1.1|270454|22|NZ_CP032898|CRISPRCasFinder 270454-270475 22 NZ_CP032898.1 1198189-1198210 1 0.955
NZ_CP032898_1 1.1|270454|22|NZ_CP032898|CRISPRCasFinder 270454-270475 22 NZ_CP032898.1 270823-270844 2 0.909
NZ_CP032898_1 1.1|270454|22|NZ_CP032898|CRISPRCasFinder 270454-270475 22 NZ_CP032898.1 616038-616059 2 0.909

1. spacer 1.1|270454|22|NZ_CP032898|CRISPRCasFinder matches to position: 615865-615886, mismatch: 0, identity: 1.0

aagggatttcttttttaaaact	CRISPR spacer
aagggatttcttttttaaaact	Protospacer
**********************

2. spacer 1.1|270454|22|NZ_CP032898|CRISPRCasFinder matches to position: 270486-270507, mismatch: 1, identity: 0.955

aagggatttcttttttaaaact	CRISPR spacer
aaggcatttcttttttaaaact	Protospacer
**** *****************

3. spacer 1.1|270454|22|NZ_CP032898|CRISPRCasFinder matches to position: 615897-615918, mismatch: 1, identity: 0.955

aagggatttcttttttaaaact	CRISPR spacer
aaggcatttcttttttaaaact	Protospacer
**** *****************

4. spacer 1.1|270454|22|NZ_CP032898|CRISPRCasFinder matches to position: 1198189-1198210, mismatch: 1, identity: 0.955

aagggatttcttttttaaaact	CRISPR spacer
aagggatttctttttttaaact	Protospacer
**************** *****

5. spacer 1.1|270454|22|NZ_CP032898|CRISPRCasFinder matches to position: 270823-270844, mismatch: 2, identity: 0.909

aagggatttcttttttaaaact	CRISPR spacer
aagggatttctttttttgaact	Protospacer
**************** .****

6. spacer 1.1|270454|22|NZ_CP032898|CRISPRCasFinder matches to position: 616038-616059, mismatch: 2, identity: 0.909

aagggatttcttttttaaaact	CRISPR spacer
aagggatttctttttttgaact	Protospacer
**************** .****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP032898_3 3.1|582887|27|NZ_CP032898|CRISPRCasFinder 582887-582913 27 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 116558-116584 3 0.889
NZ_CP032898_3 3.1|582887|27|NZ_CP032898|CRISPRCasFinder 582887-582913 27 NZ_CP022727 Erwinia persicina strain B64 plasmid pEP2, complete sequence 67408-67434 4 0.852
NZ_CP032898_3 3.2|582941|30|NZ_CP032898|CRISPRCasFinder 582941-582970 30 NC_014719 Caldicellulosiruptor kristjanssonii I77R1B plasmid pCALKR01, complete sequence 8121-8150 6 0.8

1. spacer 3.1|582887|27|NZ_CP032898|CRISPRCasFinder matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.889

-agtgtcgttattaaagctggcgttgcc	CRISPR spacer
cagt-tcgttattaaagctggggctgcc	Protospacer
 *** **************** *.****

2. spacer 3.1|582887|27|NZ_CP032898|CRISPRCasFinder matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 4, identity: 0.852

agtgtcgttattaaagctggcgttgcc	CRISPR spacer
gctgtcggtattaacgctggcgttgcc	Protospacer
. ***** ****** ************

3. spacer 3.2|582941|30|NZ_CP032898|CRISPRCasFinder matches to NC_014719 (Caldicellulosiruptor kristjanssonii I77R1B plasmid pCALKR01, complete sequence) position: , mismatch: 6, identity: 0.8

----agcactgtcattaaaagcagattgagtgct	CRISPR spacer
gattagc----tcattcaaagctgattgagtgct	Protospacer
    ***    ***** ***** ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage