Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP032899 Helicobacter pylori strain 478-A-EK1 chromosome, complete genome 1 crisprs cas3 0 2 1 0

Results visualization

1. NZ_CP032899
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032899_1 1138612-1138754 Orphan I-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP032899_1 1.2|1138700|29|NZ_CP032899|PILER-CR 1138700-1138728 29 NZ_CP017468 Staphylococcus nepalensis strain JS11 plasmid pSNJS1102, complete sequence 22517-22545 6 0.793
NZ_CP032899_1 1.1|1138640|32|NZ_CP032899|PILER-CR 1138640-1138671 32 MK448940 Streptococcus phage Javan444, complete genome 11443-11474 8 0.75
NZ_CP032899_1 1.1|1138640|32|NZ_CP032899|PILER-CR 1138640-1138671 32 MN694206 Marine virus AFVG_250M405, complete genome 17728-17759 8 0.75

1. spacer 1.2|1138700|29|NZ_CP032899|PILER-CR matches to NZ_CP017468 (Staphylococcus nepalensis strain JS11 plasmid pSNJS1102, complete sequence) position: , mismatch: 6, identity: 0.793

cagtgctcaatctgcttttaataacgata	CRISPR spacer
cacgcatcaagctgcttttagtaacgata	Protospacer
**    **** *********.********

2. spacer 1.1|1138640|32|NZ_CP032899|PILER-CR matches to MK448940 (Streptococcus phage Javan444, complete genome) position: , mismatch: 8, identity: 0.75

taacagtgccactttaagctttaatcatagcg	CRISPR spacer
tttctttgccactttaggctttcatcataggc	Protospacer
*  *  **********.***** *******  

3. spacer 1.1|1138640|32|NZ_CP032899|PILER-CR matches to MN694206 (Marine virus AFVG_250M405, complete genome) position: , mismatch: 8, identity: 0.75

taacagtgccactttaagctttaatcatagcg	CRISPR spacer
tgtcagtggcactttaagatttaatcacggta	Protospacer
*. ***** ********* ********..*..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 55795 : 66677 9 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage