Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP032913 Helicobacter pylori strain 5-A-EK1 chromosome, complete genome 2 crisprs cas3,cas14j,cas2 0 3 2 0

Results visualization

1. NZ_CP032913
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032913_1 274300-274373 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP032913_2 1101567-1101764 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP032913_1 1.1|274323|28|NZ_CP032913|CRISPRCasFinder 274323-274350 28 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 193497-193524 5 0.821
NZ_CP032913_1 1.1|274323|28|NZ_CP032913|CRISPRCasFinder 274323-274350 28 MG592531 Vibrio phage 1.164.O._10N.261.51.A7, partial genome 37126-37153 5 0.821
NZ_CP032913_2 2.3|1101711|27|NZ_CP032913|CRISPRCasFinder 1101711-1101737 27 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 1090168-1090194 5 0.815
NZ_CP032913_1 1.1|274323|28|NZ_CP032913|CRISPRCasFinder 274323-274350 28 MG945621 UNVERIFIED: Microviridae sp. isolate 5722-1702, complete genome 2067-2094 6 0.786
NZ_CP032913_2 2.2|1101654|30|NZ_CP032913|CRISPRCasFinder 1101654-1101683 30 MK448589 Streptococcus satellite phage Javan632, complete genome 4593-4622 6 0.8
NZ_CP032913_2 2.2|1101654|30|NZ_CP032913|CRISPRCasFinder 1101654-1101683 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752261-752290 9 0.7

1. spacer 1.1|274323|28|NZ_CP032913|CRISPRCasFinder matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 5, identity: 0.821

accccaccaactaaagaggaatcaaaac	CRISPR spacer
accccaccaacaaaagaggaagctcaaa	Protospacer
*********** ********* *  ** 

2. spacer 1.1|274323|28|NZ_CP032913|CRISPRCasFinder matches to MG592531 (Vibrio phage 1.164.O._10N.261.51.A7, partial genome) position: , mismatch: 5, identity: 0.821

accccaccaactaaagaggaatcaaaac	CRISPR spacer
aacgcaacaactaaacaggaatcaaaat	Protospacer
* * ** ******** ***********.

3. spacer 2.3|1101711|27|NZ_CP032913|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 5, identity: 0.815

gacaatactagctttaataacgacacc	CRISPR spacer
aagaatattagctttagtaacgacacg	Protospacer
.* ****.********.********* 

4. spacer 1.1|274323|28|NZ_CP032913|CRISPRCasFinder matches to MG945621 (UNVERIFIED: Microviridae sp. isolate 5722-1702, complete genome) position: , mismatch: 6, identity: 0.786

accccaccaactaaagaggaatcaaaac	CRISPR spacer
ccctcaccaactgaagaggaatcaatct	Protospacer
 **.********.************  .

5. spacer 2.2|1101654|30|NZ_CP032913|CRISPRCasFinder matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 6, identity: 0.8

-agtgcccaatccacttttgaaaacagcaat	CRISPR spacer
ccgta-ccaatcgccttttgaaaacagcaag	Protospacer
  **. ******  **************** 

6. spacer 2.2|1101654|30|NZ_CP032913|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 9, identity: 0.7

agtgcccaatccacttttgaaaacagcaat	CRISPR spacer
tcaaggcaatctccttttgaaaacagcaac	Protospacer
   .  *****. ****************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 373899 : 382155 8 Streptococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_2 776237 : 784485 8 Synechococcus_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage