Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041145 Bacillus velezensis strain At1 chromosome, complete genome 1 crisprs csa3,DinG,casR,cas3,DEDDh,WYL 0 1 5 0

Results visualization

1. NZ_CP041145
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041145_1 749862-750050 Orphan NA
4 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041145_1 1.2|749916|27|NZ_CP041145|CRT 749916-749942 27 KC954774 Cronobacter phage CR8, complete genome 11172-11198 4 0.852

1. spacer 1.2|749916|27|NZ_CP041145|CRT matches to KC954774 (Cronobacter phage CR8, complete genome) position: , mismatch: 4, identity: 0.852

tggggttacgggagataccggaccaac	CRISPR spacer
aggtgatacgggagataccggaccagc	Protospacer
 ** * *******************.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 657485 : 667376 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1198621 : 1230215 42 Bacillus_phage(32.26%) terminase,tail,holin,plate,portal NA
DBSCAN-SWA_3 1785526 : 1791740 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_4 2213443 : 2219696 9 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_5 2600484 : 2660392 60 uncultured_Mediterranean_phage(25.0%) coat,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage