Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041169 Alteromonas mediterranea strain PT11 chromosome, complete genome 2 crisprs DEDDh,WYL,cas3,Cas9_archaeal,csa3,DinG 3 0 2 0

Results visualization

1. NZ_CP041169
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041169_1 2580901-2581542 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041169_2 3865789-3866262 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP041169_1 1.6|2581243|18|NZ_CP041169|CRT 2581243-2581260 18 NZ_CP041169.1 1344573-1344590 1 0.944
NZ_CP041169_2 2.5|3866041|24|NZ_CP041169|CRT 3866041-3866064 24 NZ_CP041169.1 3865771-3865794 1 0.958
NZ_CP041169_2 2.8|3866209|18|NZ_CP041169|CRT 3866209-3866226 18 NZ_CP041169.1 3865771-3865788 1 0.944
NZ_CP041169_2 2.5|3866041|24|NZ_CP041169|CRT 3866041-3866064 24 NZ_CP041169.1 3866263-3866286 2 0.917

1. spacer 1.6|2581243|18|NZ_CP041169|CRT matches to position: 1344573-1344590, mismatch: 1, identity: 0.944

ttcgagcgcaggctctaa	CRISPR spacer
ttggagcgcaggctctaa	Protospacer
** ***************

2. spacer 2.5|3866041|24|NZ_CP041169|CRT matches to position: 3865771-3865794, mismatch: 1, identity: 0.958

cctctgccttagcgcgagcttccg	CRISPR spacer
cctcggccttagcgcgagcttccg	Protospacer
**** *******************

3. spacer 2.8|3866209|18|NZ_CP041169|CRT matches to position: 3865771-3865788, mismatch: 1, identity: 0.944

cctccgccttagcgcgag	CRISPR spacer
cctcggccttagcgcgag	Protospacer
**** *************

4. spacer 2.5|3866041|24|NZ_CP041169|CRT matches to position: 3866263-3866286, mismatch: 2, identity: 0.917

cctctgccttagcgcgagcttccg	CRISPR spacer
cctcagctttagcgcgagcttccg	Protospacer
**** **.****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 850239 : 858905 6 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 3728938 : 3736512 6 Enterobacteria_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage