1. spacer 2.37|260960|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_041964 (Pseudomonas phage R18 DNA, complete genome) position: , mismatch: 5, identity: 0.844
acccacggctatcggcccatttgtcgatgcgc CRISPR spacer
atcctcttctgtcggcccatttgtcgatgcgc Protospacer
*.** * **.*********************
2. spacer 2.37|260960|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_024123 (Pseudomonas phage KPP25 DNA, complete sequence) position: , mismatch: 5, identity: 0.844
acccacggctatcggcccatttgtcgatgcgc CRISPR spacer
atcctcttctgtcggcccatttgtcgatgcgc Protospacer
*.** * **.*********************
3. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.812
-atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
gatgagcg-cgtagttcgcgaggccgacaccga Protospacer
****..* **********.*** ********
4. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.812
-atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
gatgagcg-cgtagttcgcgaggccgacaccga Protospacer
****..* **********.*** ********
5. spacer 2.6|259100|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026928 (Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609b, complete sequence) position: , mismatch: 7, identity: 0.781
tgcaggccaaagatggtatcggcagggcacat- CRISPR spacer
agcatgccaaagacggtatcggcatag-gcatc Protospacer
*** ********.********** .* .***
6. spacer 2.6|259100|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.781
tgcaggccaaagatggtatcggcagggcacat- CRISPR spacer
agcatgccaaagacggtatcggcatag-gcatc Protospacer
*** ********.********** .* .***
7. spacer 2.29|260480|32|NZ_CP039374|CRISPRCasFinder,CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 7, identity: 0.781
tagggcatcggctcctttggc-tgccccgctga CRISPR spacer
tgcggcatcggctcctttggcaggccatactg- Protospacer
*. ****************** *** ..***
8. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK524507 (Mycobacterium phage Orange, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
9. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK524514 (Mycobacterium phage Bud, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
10. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK524522 (Mycobacterium phage Purgamenstris, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
11. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN310547 (Mycobacterium phage Hutc2, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
12. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK494122 (Mycobacterium phage GreaseLightnin, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
13. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MT684588 (Mycobacterium phage Snekmaggedon, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
14. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MT498042 (Mycobacterium phage Rebel, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
15. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MT498044 (Mycobacterium phage Jamie19, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
16. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_031257 (Mycobacterium phage Mulciber, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
17. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KX756439 (Mycobacterium phage PhancyPhin, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
18. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK494130 (Mycobacterium phage Fibonacci, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
19. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK392367 (Mycobacterium phage BabeRuth, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
20. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK524520 (Mycobacterium phage Nenae, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
21. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to JN624851 (Mycobacterium phage Redi, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
22. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MH536828 (Mycobacterium phage Snape, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
23. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK524509 (Mycobacterium phage SpongeBob, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
24. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MK524528 (Mycobacterium phage ShrimpFriedEgg, complete genome) position: , mismatch: 7, identity: 0.781
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
atgaacgacgtagttcgcaacggtgttctcgt Protospacer
*****.************** **.* . .***
25. spacer 2.2|258860|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
atcagaaaaatcgctgacgaaattcaaggcca CRISPR spacer
atcaggaaaatcgctggcgaaatcatgcgcga Protospacer
*****.**********.******. . ** *
26. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
actctggccaaggcgtttggcggcaaggccgg Protospacer
* ************* **.******* . *
27. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
aagctggcccaggcttatgacggcttcctcaa Protospacer
********* **** ********* ** .
28. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 8, identity: 0.75
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
gcgctggccaaggcctatgtcggcaatcccga Protospacer
. ************ **** ****** *. *
29. spacer 2.6|259100|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 8, identity: 0.75
tgcaggccaaagatggtatcggcagggcacat CRISPR spacer
tgcaggccaaaggtggaatcggcaaatctttt Protospacer
************.*** *******.. * . *
30. spacer 2.6|259100|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.75
tgcaggccaaagatggtatcggcagggcacat CRISPR spacer
agcaggccaaaggtggtctcggcaaaggccag Protospacer
***********.**** ******..* **
31. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_005045 (Pseudomonas phage phiKMV, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
32. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to AJ505558 (Bacteriophage phiKMV complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
33. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KC969441 (UNVERIFIED: Pseudomonas phage MBL, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
34. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN692672 (Pseudomonas phage vB_PaeP_Lx18, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
35. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN615698 (Pseudomonas phage vB_PaeP_SPCB, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
36. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN553588 (UNVERIFIED: Pseudomonas phage phiKMVC5-12, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
37. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_047852 (Pseudomonas phage phiNFS, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
38. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to LN610580 (Pseudomonas phage vB_PaeP_PAO1_1-15pyo, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
39. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to EU236438 (Pseudomonas phage PT2, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
40. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN553585 (UNVERIFIED: Pseudomonas phage 4phiC20-1 clone 9, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
41. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN553589 (UNVERIFIED: Pseudomonas phage phiKMVC5(121) clone 13, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
42. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_011105 (Pseudomonas phage PT5, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
43. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN602045 (Pseudomonas phage vB_PaeP_ASP23, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
44. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KX711710 (Pseudomonas phage vB_Pae-TbilisiM32, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
45. spacer 2.15|259640|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN553587 (UNVERIFIED: Pseudomonas phage phiKMVC5(121) clone 4a, complete genome) position: , mismatch: 8, identity: 0.75
ctagcgcgacagacgggcacggtcggggccaa CRISPR spacer
atgagccgacagacggcctcggtcggggccac Protospacer
*.. ********** * ************
46. spacer 2.16|259700|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aatttgaggtcatcaacacgcagcgtcaccac CRISPR spacer
tcttcgaggtcatcaatacgcagcggcgtcgc Protospacer
**.***********.******** *..*.*
47. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594187 (Siphovirus contig89 strain Day2AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
48. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594193 (Siphovirus contig89 strain Day30Noon, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
49. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594192 (Siphovirus contig89 strain Day30AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
50. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594185 (Siphovirus contig89 strain Day1Noon, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
51. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594191 (Siphovirus contig89 strain Day14AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
52. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594186 (Siphovirus contig89 strain Day1PM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
53. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594194 (Siphovirus contig89 strain Day60AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
54. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594184 (Siphovirus contig89 strain Day1AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
55. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594189 (Siphovirus contig89 strain Day7AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
56. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594188 (Siphovirus contig89 strain Day4AM, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
57. spacer 2.17|259760|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KF594190 (Siphovirus contig89 strain Day7Noon, partial genome) position: , mismatch: 8, identity: 0.75
gacaatggagagtcttcagaatcagccgccag CRISPR spacer
gaccatcgagagtcttcagaatcagtttcatt Protospacer
*** ** ******************.. *
58. spacer 2.20|259940|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgcgatacgcgaatataccggcccggtg CRISPR spacer
aatacgcgatccgcgaaaataccggcgaggcg Protospacer
.. ******* ****** ******** **.*
59. spacer 2.28|260420|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaaaatgacggcgatgcgtttcggttgg CRISPR spacer
gctgaaaaatgacggcgatccgtaaagttcgc Protospacer
****.************** *** * *.*
60. spacer 2.28|260420|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaaaatgacggcgatgcgtttcggttgg CRISPR spacer
gctgaaaaatgacggcgatccgtaaagttcgc Protospacer
****.************** *** * *.*
61. spacer 2.28|260420|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaaaatgacggcgatgcgtttcggttgg CRISPR spacer
gctgaaaaatgacggcgatccgtaaagttcgc Protospacer
****.************** *** * *.*
62. spacer 2.29|260480|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MG099950 (Arthrobacter phage Waltz, complete genome) position: , mismatch: 8, identity: 0.75
tagggcatcggctcctttggctgccccgctga CRISPR spacer
tcagagggcggcccgtttggctgccccgctga Protospacer
* .*. . ****.* *****************
63. spacer 2.29|260480|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tagggcatcggctcctttggctgccc-cgctga CRISPR spacer
ggaggcatcgggtcttttggctgcccgtgccg- Protospacer
..******** **.*********** .**.*
64. spacer 2.33|260720|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP012258 (Cronobacter universalis NCTC 9529 plasmid pCUNV1, complete sequence) position: , mismatch: 8, identity: 0.75
agtaggccacgcatccggcgttggtgtgtgcc CRISPR spacer
ggcaggccacgcttccggcgtcggtgcacacc Protospacer
.*.********* ********.****....**
65. spacer 2.43|261320|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 8, identity: 0.75
gctggcgcaggcatggcgggaggataccttgg CRISPR spacer
gctggcgcaggcagggcgggcggcttcatgct Protospacer
************* ****** ** * * *
66. spacer 2.44|261380|32|NZ_CP039374|CRISPRCasFinder,CRT matches to KY653128 (Staphylococcus phage IME1364_01, complete genome) position: , mismatch: 8, identity: 0.75
ttgaagtagaggaattttaaatgccttatccg CRISPR spacer
ttgaagtggaggaattataaatgaattgggag Protospacer
*******.******** ****** **. *
67. spacer 2.47|261560|32|NZ_CP039374|CRISPRCasFinder,CRT,PILER-CR matches to NC_020287 (Synechocystis sp. PCC 6803 plasmid pSYSA_M, complete sequence) position: , mismatch: 8, identity: 0.75
--agggtgacttaatcgatgcgatgaagaaccct CRISPR spacer
tccagatg--ttaatggaagcgatgaagaaccca Protospacer
.*.** ***** ** **************
68. spacer 2.47|261560|32|NZ_CP039374|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028097 (Synechocystis sp. IPPAS B-1465 plasmid pSYSA, complete sequence) position: , mismatch: 8, identity: 0.75
--agggtgacttaatcgatgcgatgaagaaccct CRISPR spacer
tccagatg--ttaatggaagcgatgaagaaccca Protospacer
.*.** ***** ** **************
69. spacer 2.47|261560|32|NZ_CP039374|CRISPRCasFinder,CRT,PILER-CR matches to NC_005230 (Synechocystis sp. PCC 6803 plasmid pSYSA, complete sequence) position: , mismatch: 8, identity: 0.75
--agggtgacttaatcgatgcgatgaagaaccct CRISPR spacer
tccagatg--ttaatggaagcgatgaagaaccca Protospacer
.*.** ***** ** **************
70. spacer 2.3|258920|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcgtcaacgagatatcggcctcgcccaaaac CRISPR spacer
gacttcaacgaggtatcggcctcgacctcctc Protospacer
. * ********.*********** ** *
71. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 9, identity: 0.719
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
cagctggcccaggcgtatgccggcggcctgat Protospacer
******** ********* ****.. **...
72. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 9, identity: 0.719
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
cagctggcccaggcgtatgccggcggcctgat Protospacer
******** ********* ****.. **...
73. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 9, identity: 0.719
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
cagctggcccaggcgtatgccggcggcctgat Protospacer
******** ********* ****.. **...
74. spacer 2.4|258980|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 9, identity: 0.719
aagctggccaaggcgtatgacggcaagctagc CRISPR spacer
cagctggcccaggcgtatgccggcggcctgat Protospacer
******** ********* ****.. **...
75. spacer 2.10|259340|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atgctcaggcccagaaatatcagcgcgattgc CRISPR spacer
agaaacagccccagaaagatcagcgcgaggcc Protospacer
* . *** ******** ********** *
76. spacer 2.10|259340|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719
atgctcaggcccagaaatatcagcgcgattgc CRISPR spacer
agaaacagccccagaaagatcagcgcgaggcc Protospacer
* . *** ******** ********** *
77. spacer 2.12|259460|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to MN094788 (Achromobacter phage Motura, complete genome) position: , mismatch: 9, identity: 0.719
tttcaagcagattccggttggcggggcgccat CRISPR spacer
agacgagcagattccggttggcggtacgctgg Protospacer
*.******************* .***..
78. spacer 2.12|259460|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to LN878149 (Cronobacter phage Dev-CD-23823 complete sequence) position: , mismatch: 9, identity: 0.719
tttcaagcagattccggttggcggggcgccat CRISPR spacer
gtagaagcagattccggtaggcggtgccagtt Protospacer
* ************** ***** ** *
79. spacer 2.14|259580|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 9, identity: 0.719
tatgaaggagagacggcatgaagatcctgcat CRISPR spacer
catggaggagacacggcatgaagatcggatcc Protospacer
.***.****** ************** .. .
80. spacer 2.16|259700|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aatttgaggtcatcaacacgcagcgtcaccac CRISPR spacer
gaaatatcgtcatctacatgcagcgtcaccaa Protospacer
.* *. ****** ***.************
81. spacer 2.24|260180|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP018028 (Alteromonas mediterranea strain CP49 plasmid MCP49-600, complete sequence) position: , mismatch: 9, identity: 0.719
agatagaaacggcttctattgacgaacccatc CRISPR spacer
tggaagaaacggcttctttcgacgaactatcc Protospacer
*. ************* *.*******. .*
82. spacer 2.24|260180|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP018025 (Alteromonas mediterranea strain CP48 plasmid pAMCP48-600, complete sequence) position: , mismatch: 9, identity: 0.719
agatagaaacggcttctattgacgaacccatc CRISPR spacer
tggaagaaacggcttctttcgacgaactatcc Protospacer
*. ************* *.*******. .*
83. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_021241 (Paracoccus marcusii strain DSM 11574 plasmid pMARC4, complete sequence) position: , mismatch: 9, identity: 0.719
actgtggccgacatggccgatgcctacatcca CRISPR spacer
ggagaggccgacatagccgatgcctgcaacgg Protospacer
. * *********.**********.** * .
84. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 9, identity: 0.719
actgtggccgacatggccgatgcctacatcca CRISPR spacer
ggtctggccgacaaggccgatacctaccccgc Protospacer
. * ********* *******.***** .*
85. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
actgt-ggccgacatggccgatgcctacatcca CRISPR spacer
-cagcaggccgatatggccgatccctacaagat Protospacer
* *. ******.********* ******
86. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gctgttgccgacatggtcgatgcccttttcgg Protospacer
.**** **********.*******. . ** .
87. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gctgttgccgacatggtcgatgcccttttcgg Protospacer
.**** **********.*******. . ** .
88. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN694306 (Marine virus AFVG_250M113, complete genome) position: , mismatch: 9, identity: 0.719
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gcacaggccgacatggcccaagcctacaagga Protospacer
.* ************* * ******* *
89. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
ttgtgcttcgtggtacgcaagggcgacaccgc Protospacer
** .. ***.** ****************.
90. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
ttgtgcttcgtggtacgcaagggcgacaccgc Protospacer
** .. ***.** ****************.
91. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP015745 (Shinella sp. HZN7 plasmid pShin-09, complete sequence) position: , mismatch: 9, identity: 0.719
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
ctcggagccgtggttcgcaagggcgaaaccgg Protospacer
* .. * ***.************** ****
92. spacer 2.30|260540|32|NZ_CP039374|CRISPRCasFinder,CRT matches to MN693866 (Marine virus AFVG_250M152, complete genome) position: , mismatch: 9, identity: 0.719
atgaatgacgtagttcgcaagggcgacaccgt CRISPR spacer
gagaatgtcgtagttagcaagggcgcggccaa Protospacer
. ***** ******* ********* .**.
93. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
94. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
95. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
96. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
97. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
98. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
99. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
100. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
gcgcgagaatgcggtccacgccctgaccgtcg Protospacer
.* *.*********** *** *******
101. spacer 2.34|260780|32|NZ_CP039374|CRISPRCasFinder,CRT matches to CP016642 (Mycobacterium sp. djl-10 plasmid djl-10_2, complete sequence) position: , mismatch: 9, identity: 0.719
aaatggtcggggctttttgcgttttggcggag CRISPR spacer
gccaggggcgggcttgttgcgttttgtcggag Protospacer
. ** ****** ********** *****
102. spacer 2.39|261080|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggctgcgccaagggctgggaagcaatcaa CRISPR spacer
atcggctgtgccaagggctgggtagctgaaac Protospacer
* *****.************* *** . *
103. spacer 2.41|261200|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP032704 (Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atatcgtcacgcgcacgatctaggtcgctcgt CRISPR spacer
ccatcgtcacgcgcacgttctcggtcttcggc Protospacer
.*************** *** **** .. *.
104. spacer 2.41|261200|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 9, identity: 0.719
atatcgtcacgcgcacgatctaggtcgctcgt CRISPR spacer
ccatcgtcacgcgcacgttctcggtcttcggc Protospacer
.*************** *** **** .. *.
105. spacer 2.41|261200|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 9, identity: 0.719
atatcgtcacgcgcacgatctaggtcgctcgt CRISPR spacer
ccatcgtcacgcgcacgttctcggtcttcggc Protospacer
.*************** *** **** .. *.
106. spacer 2.46|261500|32|NZ_CP039374|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045414 (Roseovarius sp. THAF8 plasmid pTHAF8_d, complete sequence) position: , mismatch: 9, identity: 0.719
atcaggctcaggttctcggaattcgtactgtt CRISPR spacer
ttcaggctcaggttttcgaaattctcgaagat Protospacer
*************.***.***** .. * *
107. spacer 2.8|259220|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030206 (Salmonella enterica strain SA20083530 plasmid pSA20083530.3, complete sequence) position: , mismatch: 10, identity: 0.688
tctgacgctaatggtaatcatcaaaggtgata CRISPR spacer
gagtgtgctaatggtaataatcaaagttgttc Protospacer
..************ ******* ** *
108. spacer 2.13|259520|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccatccttcacagtcagggcattccacaacgc CRISPR spacer
aattcctacacagtcagggcatttcatccgac Protospacer
**** ***************.**. .*
109. spacer 2.14|259580|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688
tatgaaggagagacggcatgaagatcctgcat CRISPR spacer
tgaactggagtgaaggcatgaagatcctggta Protospacer
*. . **** ** ***************
110. spacer 2.21|260000|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_021623 (Borrelia hermsii strain HS1 plasmid lp174, complete sequence) position: , mismatch: 10, identity: 0.688
gtaagtgttaatgatgagttagccgtagtgcc CRISPR spacer
aagagtgttaatgatgagttaccagttggatt Protospacer
. .****************** * ** * ...
111. spacer 2.21|260000|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gtaagtgttaatgatgagttagccgtagtgcc CRISPR spacer
aagagtgttaatgatgagttaccagttggatt Protospacer
. .****************** * ** * ...
112. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gggctggccgacaaggccgacgcctacccgga Protospacer
. ********* ******.****** . *
113. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.688
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gggctggccgacaaggccgacgcctacccgga Protospacer
. ********* ******.****** . *
114. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 10, identity: 0.688
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gggctggccgacaaggccgaggcctacccgga Protospacer
. ********* ****** ****** . *
115. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688
actgtggccgacatggccgatgcctacatcca CRISPR spacer
ggactggccgacaaggccgatgcccacgcgcg Protospacer
. ********* **********.**.. *.
116. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
actgtggccgacatggccgatgcctacatcca CRISPR spacer
gggctggccgacaaggccgacgcctacccgga Protospacer
. ********* ******.****** . *
117. spacer 2.33|260720|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
agtaggccacgcatccggcgttggtgtgtgcc CRISPR spacer
aactggccacgcattcggcgtgggtgttgatg Protospacer
*.. **********.****** ***** ..
118. spacer 2.34|260780|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
aaatggtcggggctttttgcgttttggcggag CRISPR spacer
ggggcgacggggcttgttgcgtttaggcgggt Protospacer
... * ******** ******** *****.
119. spacer 2.34|260780|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_023607 (Mycobacterium phage 40AC, complete genome) position: , mismatch: 10, identity: 0.688
aaatggtcggggctttttgcgttttggcggag CRISPR spacer
ttcggaggggggctttttgcgtttcgggggat Protospacer
*. ****************.** ***
120. spacer 2.2|258860|32|NZ_CP039374|PILER-CR,CRISPRCasFinder,CRT matches to CP031730 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
atcagaaaaatcgctgacgaaattcaaggcca CRISPR spacer
tcaagaaaaatcgatgactaaattcatcaatg Protospacer
. ********** **** ******* . ..
121. spacer 2.18|259820|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_048639 (Pseudomonas phage ZC08, complete genome) position: , mismatch: 11, identity: 0.656
cgaagctccacagtttgttcaagttcattcct CRISPR spacer
tcttgctccacagtttcatcaagttcagcttc Protospacer
. ************ ********* ....
122. spacer 2.18|259820|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NC_048638 (Pseudomonas phage ZC03, complete genome) position: , mismatch: 11, identity: 0.656
cgaagctccacagtttgttcaagttcattcct CRISPR spacer
tcttgctccacagtttcatcaagttcagcttc Protospacer
. ************ ********* ....
123. spacer 2.25|260240|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.656
actgtggccgacatggccgatgcctacatcca CRISPR spacer
ggcctggccgacaaggccgaggcctacccggc Protospacer
. . ********* ****** ****** .
124. spacer 2.31|260600|32|NZ_CP039374|CRISPRCasFinder,CRT matches to NZ_CP044336 (Enterobacter hormaechei strain AKB48 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
actcaagaatgcggtcaacggcctgacctaac CRISPR spacer
cctcacgaatgcgctcaacggcctttttggta Protospacer
**** ******* ********** .. .
