Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041280 Lactobacillus delbrueckii subsp. bulgaricus strain KLDS1.1011 chromosome, complete genome 6 crisprs DEDDh,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,cas14j,WYL,c2c9_V-U4,DinG,Cas14u_CAS-V,csa3 1 57 6 0

Results visualization

1. NZ_CP041280
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041280_1 163650-167338 TypeI-E I-B,III-A,III-B
60 spacers
DEDDh,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041280_2 233436-233562 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041280_3 354838-354961 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041280_4 361874-361984 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041280_5 702904-703042 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041280_6 1109080-1109161 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP041280_5 5.1|702956|35|NZ_CP041280|CRISPRCasFinder 702956-702990 35 NZ_CP041280.1 702884-702918 0 1.0

1. spacer 5.1|702956|35|NZ_CP041280|CRISPRCasFinder matches to position: 702884-702918, mismatch: 0, identity: 1.0 

ggcttgaggaggattttgtcgaactaacggcagaa	CRISPR spacer
ggcttgaggaggattttgtcgaactaacggcagaa	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041280_1 1.39|165997|32|NZ_CP041280|CRISPRCasFinder 165997-166028 32 EU409559 Lactobacillus phage JCL1032, complete genome 44465-44496 0 1.0
NZ_CP041280_1 1.40|166058|32|NZ_CP041280|CRISPRCasFinder 166058-166089 32 EU409559 Lactobacillus phage JCL1032, complete genome 36545-36576 0 1.0
NZ_CP041280_1 1.41|166119|32|NZ_CP041280|CRISPRCasFinder 166119-166150 32 CP031025 Lactobacillus phage ViSo-2018b, partial genome 26798-26829 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 NZ_MF191707 Lactobacillus delbrueckii strain BioLb89 plasmid p89, complete sequence 4385-4416 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 NC_004937 Lactobacillus delbrueckii subsp. lactis plasmid pLL1212, complete plasmid sequence 4163-4194 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 NC_002191 Lactobacillus delbrueckii subsp. bulgaricus plasmid pLBB1, complete plasmid sequence 4456-4487 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 CP029251 Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 plasmid p1, complete sequence 2337-2368 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 CP031024 Lactobacillus delbrueckii subsp. lactis isolate NWC_2_2 plasmid pNWC_2_2, complete sequence 3558-3589 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 NC_004849 Lactobacillus delbrueckii subsp. lactis plasmid pJBL2 6792-6823 0 1.0
NZ_CP041280_1 1.56|167034|32|NZ_CP041280|CRISPRCasFinder 167034-167065 32 NC_004850 Lactobacillus delbrueckii subsp. lactis plasmid pN42 6479-6510 0 1.0
NZ_CP041280_1 1.60|167278|32|NZ_CP041280|CRISPRCasFinder 167278-167309 32 EU409559 Lactobacillus phage JCL1032, complete genome 36814-36845 0 1.0
NZ_CP041280_1 1.99|165997|33|NZ_CP041280|CRT,PILER-CR 165997-166029 33 EU409559 Lactobacillus phage JCL1032, complete genome 44464-44496 0 1.0
NZ_CP041280_1 1.100|166058|33|NZ_CP041280|CRT,PILER-CR 166058-166090 33 EU409559 Lactobacillus phage JCL1032, complete genome 36545-36577 0 1.0
NZ_CP041280_1 1.101|166119|33|NZ_CP041280|CRT,PILER-CR 166119-166151 33 CP031025 Lactobacillus phage ViSo-2018b, partial genome 26798-26830 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 NZ_MF191707 Lactobacillus delbrueckii strain BioLb89 plasmid p89, complete sequence 4385-4417 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 NC_004937 Lactobacillus delbrueckii subsp. lactis plasmid pLL1212, complete plasmid sequence 4163-4195 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 NC_002191 Lactobacillus delbrueckii subsp. bulgaricus plasmid pLBB1, complete plasmid sequence 4456-4488 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 CP029251 Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 plasmid p1, complete sequence 2337-2369 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 CP031024 Lactobacillus delbrueckii subsp. lactis isolate NWC_2_2 plasmid pNWC_2_2, complete sequence 3558-3590 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 NC_004849 Lactobacillus delbrueckii subsp. lactis plasmid pJBL2 6792-6824 0 1.0
NZ_CP041280_1 1.116|167034|33|NZ_CP041280|CRT,PILER-CR 167034-167066 33 NC_004850 Lactobacillus delbrueckii subsp. lactis plasmid pN42 6479-6511 0 1.0
NZ_CP041280_1 1.120|167278|33|NZ_CP041280|CRT,PILER-CR 167278-167310 33 EU409559 Lactobacillus phage JCL1032, complete genome 36813-36845 0 1.0
NZ_CP041280_1 1.31|165509|32|NZ_CP041280|CRISPRCasFinder 165509-165540 32 EU409559 Lactobacillus phage JCL1032, complete genome 42324-42355 1 0.969
NZ_CP041280_1 1.91|165509|33|NZ_CP041280|CRT,PILER-CR 165509-165541 33 EU409559 Lactobacillus phage JCL1032, complete genome 42323-42355 1 0.97
NZ_CP041280_1 1.29|165387|32|NZ_CP041280|CRISPRCasFinder 165387-165418 32 NC_022775 Lactobacillus phage phiJB, complete genome 36676-36707 2 0.938
NZ_CP041280_1 1.30|165448|32|NZ_CP041280|CRISPRCasFinder 165448-165479 32 CP031025 Lactobacillus phage ViSo-2018b, partial genome 6722-6753 2 0.938
NZ_CP041280_1 1.43|166241|32|NZ_CP041280|CRISPRCasFinder 166241-166272 32 EU409559 Lactobacillus phage JCL1032, complete genome 47201-47232 2 0.938
NZ_CP041280_1 1.49|166607|32|NZ_CP041280|CRISPRCasFinder 166607-166638 32 EU409559 Lactobacillus phage JCL1032, complete genome 43528-43559 2 0.938
NZ_CP041280_1 1.89|165387|33|NZ_CP041280|CRT 165387-165419 33 NC_022775 Lactobacillus phage phiJB, complete genome 36675-36707 2 0.939
NZ_CP041280_1 1.90|165448|33|NZ_CP041280|CRT,PILER-CR 165448-165480 33 CP031025 Lactobacillus phage ViSo-2018b, partial genome 6722-6754 2 0.939
NZ_CP041280_1 1.109|166607|33|NZ_CP041280|CRT,PILER-CR 166607-166639 33 EU409559 Lactobacillus phage JCL1032, complete genome 43527-43559 2 0.939
NZ_CP041280_1 1.103|166241|33|NZ_CP041280|CRT,PILER-CR 166241-166273 33 EU409559 Lactobacillus phage JCL1032, complete genome 47200-47232 3 0.909
NZ_CP041280_1 1.14|164472|32|NZ_CP041280|CRISPRCasFinder 164472-164503 32 NC_001949 Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence 6073-6104 6 0.812
NZ_CP041280_1 1.25|165143|32|NZ_CP041280|CRISPRCasFinder 165143-165174 32 NC_001949 Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence 6073-6104 6 0.812
NZ_CP041280_1 1.31|165509|32|NZ_CP041280|CRISPRCasFinder 165509-165540 32 NC_015513 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence 72010-72041 6 0.812
NZ_CP041280_1 1.49|166607|32|NZ_CP041280|CRISPRCasFinder 166607-166638 32 HQ317391 Cyanophage S-SSM6a genomic sequence 166333-166364 6 0.812
NZ_CP041280_1 1.49|166607|32|NZ_CP041280|CRISPRCasFinder 166607-166638 32 GU071098 Synechococcus phage S-SSM7, complete genome 45307-45338 6 0.812
NZ_CP041280_1 1.59|167217|32|NZ_CP041280|CRISPRCasFinder 167217-167248 32 KX507046 Vibrio phage S4-7, complete genome 61025-61056 6 0.812
NZ_CP041280_1 1.119|167217|33|NZ_CP041280|CRT,PILER-CR 167217-167249 33 KX507046 Vibrio phage S4-7, complete genome 61025-61057 6 0.818
NZ_CP041280_1 1.1|163679|32|NZ_CP041280|CRISPRCasFinder 163679-163710 32 NZ_CP045388 Ruegeria sp. THAF33 plasmid pTHAF33_d, complete sequence 3437-3468 7 0.781
NZ_CP041280_1 1.1|163679|32|NZ_CP041280|CRISPRCasFinder 163679-163710 32 NC_023558 Cronobacter phage Dev2 complete genome 33193-33224 7 0.781
NZ_CP041280_1 1.5|163923|32|NZ_CP041280|CRISPRCasFinder 163923-163954 32 MN693285 Marine virus AFVG_25M368, complete genome 21096-21127 7 0.781
NZ_CP041280_1 1.10|164228|32|NZ_CP041280|CRISPRCasFinder 164228-164259 32 NC_041877 Pseudomonas phage SM1, complete genome 16785-16816 7 0.781
NZ_CP041280_1 1.10|164228|32|NZ_CP041280|CRISPRCasFinder 164228-164259 32 JQ067090 UNVERIFIED: Pseudomonas phage PaMx31, partial genome 40783-40814 7 0.781
NZ_CP041280_1 1.14|164472|32|NZ_CP041280|CRISPRCasFinder 164472-164503 32 MN693865 Marine virus AFVG_250M332, complete genome 30635-30666 7 0.781
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 69956-69987 7 0.781
NZ_CP041280_1 1.21|164899|32|NZ_CP041280|CRISPRCasFinder 164899-164930 32 NC_041877 Pseudomonas phage SM1, complete genome 16785-16816 7 0.781
NZ_CP041280_1 1.21|164899|32|NZ_CP041280|CRISPRCasFinder 164899-164930 32 JQ067090 UNVERIFIED: Pseudomonas phage PaMx31, partial genome 40783-40814 7 0.781
NZ_CP041280_1 1.25|165143|32|NZ_CP041280|CRISPRCasFinder 165143-165174 32 MN693865 Marine virus AFVG_250M332, complete genome 30635-30666 7 0.781
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 69956-69987 7 0.781
NZ_CP041280_1 1.51|166729|32|NZ_CP041280|CRISPRCasFinder 166729-166760 32 KT820175 Ruegeria phage 45A6, complete genome 11677-11708 7 0.781
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_LT598658 Legionella pneumophila strain Lpm7613 isolate Lpm7613 plasmid 2 51945-51976 7 0.781
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_CP021282 Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) plasmid unnamed, complete sequence 16073-16104 7 0.781
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_LN681226 Legionella hackeliae strain ATCC 35250 plasmid II, complete sequence 10940-10971 7 0.781
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_CP016031 Legionella pneumophila strain OLDA plasmid unnamed, complete sequence 36371-36402 7 0.781
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_CP021287 Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) plasmid unnamed, complete sequence 82245-82276 7 0.781
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_006365 Legionella pneumophila str. Paris plasmid pLPP, complete sequence 57475-57506 7 0.781
NZ_CP041280_1 1.58|167156|32|NZ_CP041280|CRISPRCasFinder 167156-167187 32 MF417959 Uncultured Caudovirales phage clone 2F_5, partial genome 8490-8521 7 0.781
NZ_CP041280_1 1.109|166607|33|NZ_CP041280|CRT,PILER-CR 166607-166639 33 HQ317391 Cyanophage S-SSM6a genomic sequence 166332-166364 7 0.788
NZ_CP041280_1 1.109|166607|33|NZ_CP041280|CRT,PILER-CR 166607-166639 33 GU071098 Synechococcus phage S-SSM7, complete genome 45306-45338 7 0.788
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 MF775693 Lactococcus phage LP0209, complete genome 24387-24419 7 0.788
NZ_CP041280_1 1.118|167156|33|NZ_CP041280|CRT,PILER-CR 167156-167188 33 MF417959 Uncultured Caudovirales phage clone 2F_5, partial genome 8490-8522 7 0.788
NZ_CP041280_1 1.5|163923|32|NZ_CP041280|CRISPRCasFinder 163923-163954 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 590058-590089 8 0.75
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 3185-3216 8 0.75
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NC_015579 Novosphingobium sp. PP1Y plasmid Lpl, complete sequence 46696-46727 8 0.75
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NC_009426 Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence 107243-107274 8 0.75
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NC_002033 Novosphingobium aromaticivorans plasmid pNL1, complete sequence 50635-50666 8 0.75
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 3185-3216 8 0.75
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NC_015579 Novosphingobium sp. PP1Y plasmid Lpl, complete sequence 46696-46727 8 0.75
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NC_009426 Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence 107243-107274 8 0.75
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NC_002033 Novosphingobium aromaticivorans plasmid pNL1, complete sequence 50635-50666 8 0.75
NZ_CP041280_1 1.34|165692|32|NZ_CP041280|CRISPRCasFinder 165692-165723 32 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 323530-323561 8 0.75
NZ_CP041280_1 1.34|165692|32|NZ_CP041280|CRISPRCasFinder 165692-165723 32 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 915575-915606 8 0.75
NZ_CP041280_1 1.34|165692|32|NZ_CP041280|CRISPRCasFinder 165692-165723 32 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 115879-115910 8 0.75
NZ_CP041280_1 1.42|166180|32|NZ_CP041280|CRISPRCasFinder 166180-166211 32 NZ_CP043057 Dolichospermum sp. UHCC 0315A plasmid pUHCC0315a, complete sequence 39943-39974 8 0.75
NZ_CP041280_1 1.42|166180|32|NZ_CP041280|CRISPRCasFinder 166180-166211 32 NZ_CP043058 Dolichospermum sp. UHCC 0315A plasmid pUHCC0315b, complete sequence 45040-45071 8 0.75
NZ_CP041280_1 1.45|166363|32|NZ_CP041280|CRISPRCasFinder 166363-166394 32 MK415407 Phage FAKO27_000271F, complete genome 11760-11791 8 0.75
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 MF775693 Lactococcus phage LP0209, complete genome 24388-24419 8 0.75
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 KF806588 Erwinia phage Ea9-2, complete genome 24233-24264 8 0.75
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_049397 Lactococcus phage 05601, complete genome 25192-25223 8 0.75
NZ_CP041280_1 1.59|167217|32|NZ_CP041280|CRISPRCasFinder 167217-167248 32 EU409559 Lactobacillus phage JCL1032, complete genome 48510-48541 8 0.75
NZ_CP041280_1 1.59|167217|32|NZ_CP041280|CRISPRCasFinder 167217-167248 32 NZ_AP018682 Vibrio casei strain DSM 22364 plasmid 1, complete sequence 104640-104671 8 0.75
NZ_CP041280_1 1.59|167217|32|NZ_CP041280|CRISPRCasFinder 167217-167248 32 NZ_AP018688 Vibrio rumoiensis strain FERM P-14531 plasmid 2, complete sequence 22512-22543 8 0.75
NZ_CP041280_1 1.59|167217|32|NZ_CP041280|CRISPRCasFinder 167217-167248 32 HQ634175 Cyanophage P-RSM1 genomic sequence 4331-4362 8 0.75
NZ_CP041280_1 1.70|164228|33|NZ_CP041280|PILER-CR,CRT 164228-164260 33 NC_041877 Pseudomonas phage SM1, complete genome 16785-16817 8 0.758
NZ_CP041280_1 1.70|164228|33|NZ_CP041280|PILER-CR,CRT 164228-164260 33 JQ067090 UNVERIFIED: Pseudomonas phage PaMx31, partial genome 40783-40815 8 0.758
NZ_CP041280_1 1.74|164472|33|NZ_CP041280|PILER-CR,CRT 164472-164504 33 NC_001949 Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence 6072-6104 8 0.758
NZ_CP041280_1 1.74|164472|33|NZ_CP041280|PILER-CR,CRT 164472-164504 33 MN693865 Marine virus AFVG_250M332, complete genome 30635-30667 8 0.758
NZ_CP041280_1 1.76|164594|33|NZ_CP041280|PILER-CR,CRT 164594-164626 33 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 3184-3216 8 0.758
NZ_CP041280_1 1.81|164899|33|NZ_CP041280|CRT 164899-164931 33 NC_041877 Pseudomonas phage SM1, complete genome 16785-16817 8 0.758
NZ_CP041280_1 1.81|164899|33|NZ_CP041280|CRT 164899-164931 33 JQ067090 UNVERIFIED: Pseudomonas phage PaMx31, partial genome 40783-40815 8 0.758
NZ_CP041280_1 1.85|165143|33|NZ_CP041280|CRT 165143-165175 33 NC_001949 Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence 6072-6104 8 0.758
NZ_CP041280_1 1.85|165143|33|NZ_CP041280|CRT 165143-165175 33 MN693865 Marine virus AFVG_250M332, complete genome 30635-30667 8 0.758
NZ_CP041280_1 1.87|165265|33|NZ_CP041280|CRT 165265-165297 33 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 3184-3216 8 0.758
NZ_CP041280_1 1.102|166180|33|NZ_CP041280|CRT,PILER-CR 166180-166212 33 NZ_CP043057 Dolichospermum sp. UHCC 0315A plasmid pUHCC0315a, complete sequence 39942-39974 8 0.758
NZ_CP041280_1 1.102|166180|33|NZ_CP041280|CRT,PILER-CR 166180-166212 33 NZ_CP043058 Dolichospermum sp. UHCC 0315A plasmid pUHCC0315b, complete sequence 45039-45071 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NZ_LT598658 Legionella pneumophila strain Lpm7613 isolate Lpm7613 plasmid 2 51944-51976 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NZ_LN681226 Legionella hackeliae strain ATCC 35250 plasmid II, complete sequence 10939-10971 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NZ_CP021287 Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) plasmid unnamed, complete sequence 82244-82276 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NC_006365 Legionella pneumophila str. Paris plasmid pLPP, complete sequence 57474-57506 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NZ_CP021282 Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) plasmid unnamed, complete sequence 16073-16105 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NZ_CP016031 Legionella pneumophila strain OLDA plasmid unnamed, complete sequence 36371-36403 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 DQ054536 Lactococcus phage P008, complete genome 21919-21951 8 0.758
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NC_049370 Lactococcus phage 936 group phage PhiS0139, complete genome 23969-24001 8 0.758
NZ_CP041280_1 1.12|164350|32|NZ_CP041280|CRISPRCasFinder 164350-164381 32 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 198011-198042 9 0.719
NZ_CP041280_1 1.14|164472|32|NZ_CP041280|CRISPRCasFinder 164472-164503 32 MN693975 Marine virus AFVG_250M1117, complete genome 24994-25025 9 0.719
NZ_CP041280_1 1.15|164533|32|NZ_CP041280|CRISPRCasFinder 164533-164564 32 EU409559 Lactobacillus phage JCL1032, complete genome 42176-42207 9 0.719
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1589546-1589577 9 0.719
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1390377-1390408 9 0.719
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1589672-1589703 9 0.719
NZ_CP041280_1 1.16|164594|32|NZ_CP041280|CRISPRCasFinder 164594-164625 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1341713-1341744 9 0.719
NZ_CP041280_1 1.23|165021|32|NZ_CP041280|CRISPRCasFinder 165021-165052 32 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 198011-198042 9 0.719
NZ_CP041280_1 1.25|165143|32|NZ_CP041280|CRISPRCasFinder 165143-165174 32 MN693975 Marine virus AFVG_250M1117, complete genome 24994-25025 9 0.719
NZ_CP041280_1 1.26|165204|32|NZ_CP041280|CRISPRCasFinder 165204-165235 32 EU409559 Lactobacillus phage JCL1032, complete genome 42176-42207 9 0.719
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1589546-1589577 9 0.719
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1390377-1390408 9 0.719
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1589672-1589703 9 0.719
NZ_CP041280_1 1.27|165265|32|NZ_CP041280|CRISPRCasFinder 165265-165296 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1341713-1341744 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_KU525621 Bacillus anthracis strain P.NO2 plasmid pXO2, complete sequence 57671-57702 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NC_014332 Bacillus cereus biovar anthracis str. CI plasmid pCI-XO2, complete sequence 58360-58391 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NC_012577 Bacillus anthracis str. CDC 684 plasmid pX02, complete sequence 56309-56340 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP015778 Bacillus anthracis strain Tangail-1 plasmid pXO2, complete sequence 57889-57920 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP018905 Bacillus anthracis strain Tyrol 4675 plasmid pXO2, complete sequence 58239-58270 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP023003 Bacillus anthracis strain 14RA5914 plasmid pX02, complete sequence 88098-88129 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_AP019733 Bacillus anthracis strain PCr plasmid PCr-pXO2 93877-93908 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_AP018445 Bacillus anthracis strain CZC5 plasmid pXO2, complete sequence 57885-57916 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP029325 Bacillus anthracis strain 17OD930 plasmid pXO2, complete sequence 46181-46212 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NC_012655 Bacillus anthracis str. A0248 plasmid pXO2, complete sequence 58932-58963 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NC_007323 Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence 57889-57920 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP010854 Bacillus anthracis strain A1144 plasmid pXO2, complete sequence 58049-58080 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP007617 Bacillus anthracis strain 2000031021 plasmid pXO2, complete sequence 33467-33498 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP008848 Bacillus anthracis strain HYU01 plasmid pX02, complete sequence 57806-57837 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP006744 Bacillus anthracis str. SVA11 plasmid pXO2, complete sequence 57839-57870 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_AP014835 Bacillus anthracis strain Shikan-NIID plasmid pXO2 57886-57917 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP029807 Bacillus anthracis strain London_499 plasmid pX02, complete sequence 57808-57839 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NC_002146 Bacillus anthracis plasmid pXO2, complete sequence 58379-58410 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NC_017727 Bacillus anthracis str. H9401 plasmid BAP2, complete sequence 57888-57919 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009314 Bacillus anthracis str. Turkey32 strain 35 plasmid unnamed, complete sequence 64736-64767 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP014178 Bacillus anthracis strain Stendal plasmid pXO2, complete sequence 57889-57920 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009475 Bacillus anthracis strain Pasteur plasmid pXO2, complete sequence 80387-80418 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009900 Bacillus anthracis strain 2002013094 plasmid pXO2, complete sequence 42921-42952 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009339 Bacillus anthracis strain Ohio ACB plasmid 2, complete sequence 77171-77202 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009695 Bacillus anthracis strain RA3 plasmid pXO2, complete sequence 45893-45924 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009462 Bacillus anthracis strain SK-102 plasmid pXO2, complete sequence 85482-85513 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009698 Bacillus anthracis strain BA1035 plasmid pXO2, complete sequence 55088-55119 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009542 Bacillus anthracis strain BA1015 plasmid pXO2, complete sequence 71454-71485 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP010320 Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 2, complete sequence 42630-42661 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009329 Bacillus anthracis strain K3 plasmid 2, complete sequence 92161-92192 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009326 Bacillus anthracis strain Vollum 1B plasmid 2, complete sequence 71425-71456 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP009979 Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed2, complete sequence 15590-15621 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP001972 Bacillus anthracis str. A16 plasmid pXO2, complete sequence 57887-57918 9 0.719
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP047133 Bacillus anthracis str. BF1 plasmid pXO2, complete sequence 57824-57855 9 0.719
NZ_CP041280_1 1.49|166607|32|NZ_CP041280|CRISPRCasFinder 166607-166638 32 MH319726 Marine virus AG-345-D19 Ga0172267_107 genomic sequence 4232-4263 9 0.719
NZ_CP041280_1 1.49|166607|32|NZ_CP041280|CRISPRCasFinder 166607-166638 32 KY744240 Weissella phage PWc, complete genome 22314-22345 9 0.719
NZ_CP041280_1 1.51|166729|32|NZ_CP041280|CRISPRCasFinder 166729-166760 32 NZ_CP019447 Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence 6824-6855 9 0.719
NZ_CP041280_1 1.52|166790|32|NZ_CP041280|CRISPRCasFinder 166790-166821 32 NZ_CP031358 Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence 390509-390540 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 DQ054536 Lactococcus phage P008, complete genome 21920-21951 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 KF676640 Lactococcus phage SK1833, complete genome 20666-20697 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_001835 Lactococcus phage sk1, complete genome 20666-20697 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 GQ979703 Lactococcus lactis phage p2, complete genome 20503-20534 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 MF448567 Lactococcus phage 66901, complete genome 22143-22174 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_049370 Lactococcus phage 936 group phage PhiS0139, complete genome 23970-24001 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 AF011378 Bacteriophage sk1 complete genome 20666-20697 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_KU356480 Vibrio parahaemolyticus strain VPS92 plasmid pVPS92-VEB, complete sequence 57744-57775 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_CP013139 Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence 755429-755460 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_CP053812 Vibrio cholerae strain W6G plasmid pW6G, complete sequence 183713-183744 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_CP053815 Vibrio cholerae strain W7G plasmid pW7G, complete sequence 139544-139575 9 0.719
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 322173-322204 9 0.719
NZ_CP041280_1 1.65|163923|33|NZ_CP041280|PILER-CR,CRT 163923-163955 33 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 590058-590090 9 0.727
NZ_CP041280_1 1.76|164594|33|NZ_CP041280|PILER-CR,CRT 164594-164626 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1589545-1589577 9 0.727
NZ_CP041280_1 1.76|164594|33|NZ_CP041280|PILER-CR,CRT 164594-164626 33 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1390376-1390408 9 0.727
NZ_CP041280_1 1.76|164594|33|NZ_CP041280|PILER-CR,CRT 164594-164626 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1589671-1589703 9 0.727
NZ_CP041280_1 1.76|164594|33|NZ_CP041280|PILER-CR,CRT 164594-164626 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1341712-1341744 9 0.727
NZ_CP041280_1 1.76|164594|33|NZ_CP041280|PILER-CR,CRT 164594-164626 33 NC_015579 Novosphingobium sp. PP1Y plasmid Lpl, complete sequence 46695-46727 9 0.727
NZ_CP041280_1 1.87|165265|33|NZ_CP041280|CRT 165265-165297 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1589545-1589577 9 0.727
NZ_CP041280_1 1.87|165265|33|NZ_CP041280|CRT 165265-165297 33 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1390376-1390408 9 0.727
NZ_CP041280_1 1.87|165265|33|NZ_CP041280|CRT 165265-165297 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1589671-1589703 9 0.727
NZ_CP041280_1 1.87|165265|33|NZ_CP041280|CRT 165265-165297 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1341712-1341744 9 0.727
NZ_CP041280_1 1.87|165265|33|NZ_CP041280|CRT 165265-165297 33 NC_015579 Novosphingobium sp. PP1Y plasmid Lpl, complete sequence 46695-46727 9 0.727
NZ_CP041280_1 1.94|165692|33|NZ_CP041280|CRT,PILER-CR 165692-165724 33 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 323530-323562 9 0.727
NZ_CP041280_1 1.94|165692|33|NZ_CP041280|CRT,PILER-CR 165692-165724 33 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 915575-915607 9 0.727
NZ_CP041280_1 1.94|165692|33|NZ_CP041280|CRT,PILER-CR 165692-165724 33 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 115879-115911 9 0.727
NZ_CP041280_1 1.105|166363|33|NZ_CP041280|CRT,PILER-CR 166363-166395 33 MK415407 Phage FAKO27_000271F, complete genome 11760-11792 9 0.727
NZ_CP041280_1 1.111|166729|33|NZ_CP041280|CRT,PILER-CR 166729-166761 33 NZ_CP019447 Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence 6823-6855 9 0.727
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 KF806588 Erwinia phage Ea9-2, complete genome 24233-24265 9 0.727
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NC_049397 Lactococcus phage 05601, complete genome 25191-25223 9 0.727
NZ_CP041280_1 1.119|167217|33|NZ_CP041280|CRT,PILER-CR 167217-167249 33 EU409559 Lactobacillus phage JCL1032, complete genome 48509-48541 9 0.727
NZ_CP041280_1 1.119|167217|33|NZ_CP041280|CRT,PILER-CR 167217-167249 33 NZ_AP018682 Vibrio casei strain DSM 22364 plasmid 1, complete sequence 104640-104672 9 0.727
NZ_CP041280_1 1.119|167217|33|NZ_CP041280|CRT,PILER-CR 167217-167249 33 NZ_AP018688 Vibrio rumoiensis strain FERM P-14531 plasmid 2, complete sequence 22512-22544 9 0.727
NZ_CP041280_1 1.43|166241|32|NZ_CP041280|CRISPRCasFinder 166241-166272 32 KJ081346 Bacillus phage BCP8-2, complete genome 54795-54826 10 0.688
NZ_CP041280_1 1.43|166241|32|NZ_CP041280|CRISPRCasFinder 166241-166272 32 NC_027352 Bacillus phage JBP901, complete genome 17302-17333 10 0.688
NZ_CP041280_1 1.43|166241|32|NZ_CP041280|CRISPRCasFinder 166241-166272 32 MG602477 Bacillus phage BCP01, complete genome 5228-5259 10 0.688
NZ_CP041280_1 1.43|166241|32|NZ_CP041280|CRISPRCasFinder 166241-166272 32 KX495186 Bacillus phage PK16, complete genome 14955-14986 10 0.688
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 118874-118905 10 0.688
NZ_CP041280_1 1.51|166729|32|NZ_CP041280|CRISPRCasFinder 166729-166760 32 NZ_KF418775 Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence 72035-72066 10 0.688
NZ_CP041280_1 1.51|166729|32|NZ_CP041280|CRISPRCasFinder 166729-166760 32 MH248138 Erwinia phage vB_EamM_Alexandra, complete genome 136892-136923 10 0.688
NZ_CP041280_1 1.51|166729|32|NZ_CP041280|CRISPRCasFinder 166729-166760 32 MH460463 Dickeya phage vB_DsoM_AD1, complete genome 136935-136966 10 0.688
NZ_CP041280_1 1.52|166790|32|NZ_CP041280|CRISPRCasFinder 166790-166821 32 KT919973 Vibrio phage phi-ST2, complete genome 91508-91539 10 0.688
NZ_CP041280_1 1.54|166912|32|NZ_CP041280|CRISPRCasFinder 166912-166943 32 NZ_CP008877 Terribacillus goriensis strain MP602 plasmid pT1, complete sequence 72728-72759 10 0.688
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_008371 Lactococcus phage jj50, complete genome 20478-20509 10 0.688
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_010363 Lactococcus phage asccphi28, complete genome 16603-16634 10 0.688
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 MF448563 Lactococcus phage 57001, complete genome 25374-25405 10 0.688
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 NC_049414 Lactococcus phage 96403, complete genome 20437-20468 10 0.688
NZ_CP041280_1 1.55|166973|32|NZ_CP041280|CRISPRCasFinder 166973-167004 32 DQ227764 Lactococcus lactis phage jj50, complete genome 20478-20509 10 0.688
NZ_CP041280_1 1.59|167217|32|NZ_CP041280|CRISPRCasFinder 167217-167248 32 MT648819 Acinetobacter phage C001, partial genome 27319-27350 10 0.688
NZ_CP041280_1 1.112|166790|33|NZ_CP041280|CRT,PILER-CR 166790-166822 33 NZ_CP031358 Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence 390508-390540 10 0.697
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 KF676640 Lactococcus phage SK1833, complete genome 20665-20697 10 0.697
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 NC_001835 Lactococcus phage sk1, complete genome 20665-20697 10 0.697
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 GQ979703 Lactococcus lactis phage p2, complete genome 20502-20534 10 0.697
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 MF448567 Lactococcus phage 66901, complete genome 22142-22174 10 0.697
NZ_CP041280_1 1.115|166973|33|NZ_CP041280|CRT,PILER-CR 166973-167005 33 AF011378 Bacteriophage sk1 complete genome 20665-20697 10 0.697
NZ_CP041280_1 1.14|164472|32|NZ_CP041280|CRISPRCasFinder 164472-164503 32 NZ_CP026415 Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence 20932-20963 11 0.656
NZ_CP041280_1 1.25|165143|32|NZ_CP041280|CRISPRCasFinder 165143-165174 32 NZ_CP026415 Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence 20932-20963 11 0.656
NZ_CP041280_1 1.48|166546|32|NZ_CP041280|CRISPRCasFinder 166546-166577 32 NZ_LR723671 Rhizobium flavum strain YW14 plasmid 2 164988-165019 11 0.656
NZ_CP041280_1 1.51|166729|32|NZ_CP041280|CRISPRCasFinder 166729-166760 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 602911-602942 11 0.656

1. spacer 1.39|165997|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0 

cctatatcgtaaaccaccgaaacactgacagc	CRISPR spacer
cctatatcgtaaaccaccgaaacactgacagc	Protospacer
********************************

2. spacer 1.40|166058|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0 

cccttactggcaacatgattactagcaataca	CRISPR spacer
cccttactggcaacatgattactagcaataca	Protospacer
********************************

3. spacer 1.41|166119|32|NZ_CP041280|CRISPRCasFinder matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 0, identity: 1.0 

ttttctaattggcagaaatccaatacttcatc	CRISPR spacer
ttttctaattggcagaaatccaatacttcatc	Protospacer
********************************

4. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to NZ_MF191707 (Lactobacillus delbrueckii strain BioLb89 plasmid p89, complete sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

5. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to NC_004937 (Lactobacillus delbrueckii subsp. lactis plasmid pLL1212, complete plasmid sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

6. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to NC_002191 (Lactobacillus delbrueckii subsp. bulgaricus plasmid pLBB1, complete plasmid sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

7. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to CP029251 (Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

8. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to CP031024 (Lactobacillus delbrueckii subsp. lactis isolate NWC_2_2 plasmid pNWC_2_2, complete sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

9. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to NC_004849 (Lactobacillus delbrueckii subsp. lactis plasmid pJBL2) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

10. spacer 1.56|167034|32|NZ_CP041280|CRISPRCasFinder matches to NC_004850 (Lactobacillus delbrueckii subsp. lactis plasmid pN42) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatt	CRISPR spacer
taggctactccccgttgaccaacagcattatt	Protospacer
********************************

11. spacer 1.60|167278|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0 

tctgggtccttgccagtccagaatgccaaatc	CRISPR spacer
tctgggtccttgccagtccagaatgccaaatc	Protospacer
********************************

12. spacer 1.99|165997|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0 

cctatatcgtaaaccaccgaaacactgacagca	CRISPR spacer
cctatatcgtaaaccaccgaaacactgacagca	Protospacer
*********************************

13. spacer 1.100|166058|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0 

cccttactggcaacatgattactagcaatacaa	CRISPR spacer
cccttactggcaacatgattactagcaatacaa	Protospacer
*********************************

14. spacer 1.101|166119|33|NZ_CP041280|CRT,PILER-CR matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 0, identity: 1.0 

ttttctaattggcagaaatccaatacttcatca	CRISPR spacer
ttttctaattggcagaaatccaatacttcatca	Protospacer
*********************************

15. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to NZ_MF191707 (Lactobacillus delbrueckii strain BioLb89 plasmid p89, complete sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

16. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to NC_004937 (Lactobacillus delbrueckii subsp. lactis plasmid pLL1212, complete plasmid sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

17. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to NC_002191 (Lactobacillus delbrueckii subsp. bulgaricus plasmid pLBB1, complete plasmid sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

18. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to CP029251 (Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

19. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to CP031024 (Lactobacillus delbrueckii subsp. lactis isolate NWC_2_2 plasmid pNWC_2_2, complete sequence) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

20. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to NC_004849 (Lactobacillus delbrueckii subsp. lactis plasmid pJBL2) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

21. spacer 1.116|167034|33|NZ_CP041280|CRT,PILER-CR matches to NC_004850 (Lactobacillus delbrueckii subsp. lactis plasmid pN42) position: , mismatch: 0, identity: 1.0 

taggctactccccgttgaccaacagcattatta	CRISPR spacer
taggctactccccgttgaccaacagcattatta	Protospacer
*********************************

22. spacer 1.120|167278|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 0, identity: 1.0 

tctgggtccttgccagtccagaatgccaaatca	CRISPR spacer
tctgggtccttgccagtccagaatgccaaatca	Protospacer
*********************************

23. spacer 1.31|165509|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 1, identity: 0.969 

agtaatcgatgcctttatcaaacttaaagcat	CRISPR spacer
aataatcgatgcctttatcaaacttaaagcat	Protospacer
*.******************************

24. spacer 1.91|165509|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 1, identity: 0.97 

agtaatcgatgcctttatcaaacttaaagcatg	CRISPR spacer
aataatcgatgcctttatcaaacttaaagcatg	Protospacer
*.*******************************

25. spacer 1.29|165387|32|NZ_CP041280|CRISPRCasFinder matches to NC_022775 (Lactobacillus phage phiJB, complete genome) position: , mismatch: 2, identity: 0.938 

cagtaaagcatgcgataatcgtgcatgtcata	CRISPR spacer
cagtaaagcatacgatagtcgtgcatgtcata	Protospacer
***********.*****.**************

26. spacer 1.30|165448|32|NZ_CP041280|CRISPRCasFinder matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 2, identity: 0.938 

gaattcgtattaatcgccgcaacaatctgccc	CRISPR spacer
gaactcgtattaatagccgcaacaatctgccc	Protospacer
***.********** *****************

27. spacer 1.43|166241|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 2, identity: 0.938 

tgggctttttccttacgctcttaattatactc	CRISPR spacer
tgggcttttttcttacactcttaattatactc	Protospacer
**********.*****.***************

28. spacer 1.49|166607|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 2, identity: 0.938 

ttcatcatagtgtggataatcttcaagcaaag	CRISPR spacer
ttcgtcatagtgtggatagtcttcaagcaaag	Protospacer
***.**************.*************

29. spacer 1.89|165387|33|NZ_CP041280|CRT matches to NC_022775 (Lactobacillus phage phiJB, complete genome) position: , mismatch: 2, identity: 0.939 

cagtaaagcatgcgataatcgtgcatgtcatag	CRISPR spacer
cagtaaagcatacgatagtcgtgcatgtcatag	Protospacer
***********.*****.***************

30. spacer 1.90|165448|33|NZ_CP041280|CRT,PILER-CR matches to CP031025 (Lactobacillus phage ViSo-2018b, partial genome) position: , mismatch: 2, identity: 0.939 

gaattcgtattaatcgccgcaacaatctgccca	CRISPR spacer
gaactcgtattaatagccgcaacaatctgccca	Protospacer
***.********** ******************

31. spacer 1.109|166607|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 2, identity: 0.939 

ttcatcatagtgtggataatcttcaagcaaaga	CRISPR spacer
ttcgtcatagtgtggatagtcttcaagcaaaga	Protospacer
***.**************.**************

32. spacer 1.103|166241|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 3, identity: 0.909 

tgggctttttccttacgctcttaattatactcg	CRISPR spacer
tgggcttttttcttacactcttaattatactca	Protospacer
**********.*****.***************.

33. spacer 1.14|164472|32|NZ_CP041280|CRISPRCasFinder matches to NC_001949 (Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence) position: , mismatch: 6, identity: 0.812 

agtttttcttaaattcttgttcagtagtcatt-	CRISPR spacer
agtttattttaaattcttgttcag-ggtggttt	Protospacer
***** *.**************** .** .**

34. spacer 1.25|165143|32|NZ_CP041280|CRISPRCasFinder matches to NC_001949 (Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence) position: , mismatch: 6, identity: 0.812 

agtttttcttaaattcttgttcagtagtcatt-	CRISPR spacer
agtttattttaaattcttgttcag-ggtggttt	Protospacer
***** *.**************** .** .**

35. spacer 1.31|165509|32|NZ_CP041280|CRISPRCasFinder matches to NC_015513 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence) position: , mismatch: 6, identity: 0.812 

agtaatcgatgcctttatcaaacttaaagcat-	CRISPR spacer
ggtaatcgatgccttgagcaaac-tacagcaca	Protospacer
.************** * ***** ** ****.

36. spacer 1.49|166607|32|NZ_CP041280|CRISPRCasFinder matches to HQ317391 (Cyanophage S-SSM6a genomic sequence) position: , mismatch: 6, identity: 0.812 

ttcatcatagtgtggataatcttcaagcaaag	CRISPR spacer
atcatcatagtgacgataatcttcaagtgaat	Protospacer
 ***********  *************..**

37. spacer 1.49|166607|32|NZ_CP041280|CRISPRCasFinder matches to GU071098 (Synechococcus phage S-SSM7, complete genome) position: , mismatch: 6, identity: 0.812 

ttcatcatagtgtggataatcttcaagcaaag	CRISPR spacer
atcatcatagtgacgataatcttcaagtgaat	Protospacer
 ***********  *************..**

38. spacer 1.59|167217|32|NZ_CP041280|CRISPRCasFinder matches to KX507046 (Vibrio phage S4-7, complete genome) position: , mismatch: 6, identity: 0.812 

tcaaatta-aaacacatattcagaaataacatc	CRISPR spacer
-cacattgtcaactcatattcagaaataaaatc	Protospacer
 ** ***.  *** *************** ***

39. spacer 1.119|167217|33|NZ_CP041280|CRT,PILER-CR matches to KX507046 (Vibrio phage S4-7, complete genome) position: , mismatch: 6, identity: 0.818 

tcaaatta-aaacacatattcagaaataacatca	CRISPR spacer
-cacattgtcaactcatattcagaaataaaatca	Protospacer
 ** ***.  *** *************** ****

40. spacer 1.1|163679|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP045388 (Ruegeria sp. THAF33 plasmid pTHAF33_d, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgggcaggagtttatcattctgggcaagaac	CRISPR spacer
accggcaggagttcatccttctgggcgacatc	Protospacer
 * **********.*** ********.* * *

41. spacer 1.1|163679|32|NZ_CP041280|CRISPRCasFinder matches to NC_023558 (Cronobacter phage Dev2 complete genome) position: , mismatch: 7, identity: 0.781 

tcgggcaggagtttatcattctgggcaagaac	CRISPR spacer
tcctgaatcagattatccttctgggcaagaac	Protospacer
**  * *  ** ***** **************

42. spacer 1.5|163923|32|NZ_CP041280|CRISPRCasFinder matches to MN693285 (Marine virus AFVG_25M368, complete genome) position: , mismatch: 7, identity: 0.781 

--ctgacggcaatttttacggggcatcttgccta	CRISPR spacer
ttctaaca--catttttacgtggcatcttaccta	Protospacer
  **.**.   ********* ********.****

43. spacer 1.10|164228|32|NZ_CP041280|CRISPRCasFinder matches to NC_041877 (Pseudomonas phage SM1, complete genome) position: , mismatch: 7, identity: 0.781 

ccagtcagtccggactttgcgtaggttggctc	CRISPR spacer
acggagaatctggactttgcgcaggttggctc	Protospacer
 *.*  *.**.**********.**********

44. spacer 1.10|164228|32|NZ_CP041280|CRISPRCasFinder matches to JQ067090 (UNVERIFIED: Pseudomonas phage PaMx31, partial genome) position: , mismatch: 7, identity: 0.781 

ccagtcagtccggactttgcgtaggttggctc	CRISPR spacer
acggagaatctggactttgcgcaggttggctc	Protospacer
 *.*  *.**.**********.**********

45. spacer 1.14|164472|32|NZ_CP041280|CRISPRCasFinder matches to MN693865 (Marine virus AFVG_250M332, complete genome) position: , mismatch: 7, identity: 0.781 

agtttttcttaaattcttgttcagtagtcatt	CRISPR spacer
attgcatattaaattgttgttcaggagtcatt	Protospacer
* * . * ******* ******** *******

46. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 7, identity: 0.781 

--tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
gtgccgta--ccacttgccgacgtcgtcgccgtc	Protospacer
   *** *  *** ******* ***********

47. spacer 1.21|164899|32|NZ_CP041280|CRISPRCasFinder matches to NC_041877 (Pseudomonas phage SM1, complete genome) position: , mismatch: 7, identity: 0.781 

ccagtcagtccggactttgcgtaggttggctc	CRISPR spacer
acggagaatctggactttgcgcaggttggctc	Protospacer
 *.*  *.**.**********.**********

48. spacer 1.21|164899|32|NZ_CP041280|CRISPRCasFinder matches to JQ067090 (UNVERIFIED: Pseudomonas phage PaMx31, partial genome) position: , mismatch: 7, identity: 0.781 

ccagtcagtccggactttgcgtaggttggctc	CRISPR spacer
acggagaatctggactttgcgcaggttggctc	Protospacer
 *.*  *.**.**********.**********

49. spacer 1.25|165143|32|NZ_CP041280|CRISPRCasFinder matches to MN693865 (Marine virus AFVG_250M332, complete genome) position: , mismatch: 7, identity: 0.781 

agtttttcttaaattcttgttcagtagtcatt	CRISPR spacer
attgcatattaaattgttgttcaggagtcatt	Protospacer
* * . * ******* ******** *******

50. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 7, identity: 0.781 

--tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
gtgccgta--ccacttgccgacgtcgtcgccgtc	Protospacer
   *** *  *** ******* ***********

51. spacer 1.51|166729|32|NZ_CP041280|CRISPRCasFinder matches to KT820175 (Ruegeria phage 45A6, complete genome) position: , mismatch: 7, identity: 0.781 

cctttagctcttcggcgaacgcttcgctttcc-	CRISPR spacer
ccttgatctcttcggcgaacgc-tcgcggcctg	Protospacer
**** * *************** ****  .*.

52. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_LT598658 (Legionella pneumophila strain Lpm7613 isolate Lpm7613 plasmid 2) position: , mismatch: 7, identity: 0.781 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagag	Protospacer
*   ***.*******************.**

53. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP021282 (Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagag	Protospacer
*   ***.*******************.**

54. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_LN681226 (Legionella hackeliae strain ATCC 35250 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagag	Protospacer
*   ***.*******************.**

55. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP016031 (Legionella pneumophila strain OLDA plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagag	Protospacer
*   ***.*******************.**

56. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP021287 (Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagag	Protospacer
*   ***.*******************.**

57. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_006365 (Legionella pneumophila str. Paris plasmid pLPP, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagag	Protospacer
*   ***.*******************.**

58. spacer 1.58|167156|32|NZ_CP041280|CRISPRCasFinder matches to MF417959 (Uncultured Caudovirales phage clone 2F_5, partial genome) position: , mismatch: 7, identity: 0.781 

ccgaaaatatcgatgttgttcgtcaaatagat	CRISPR spacer
cgttaaatatagatgttgttcgtaaaataact	Protospacer
*   ****** ************ *****. *

59. spacer 1.109|166607|33|NZ_CP041280|CRT,PILER-CR matches to HQ317391 (Cyanophage S-SSM6a genomic sequence) position: , mismatch: 7, identity: 0.788 

ttcatcatagtgtggataatcttcaagcaaaga	CRISPR spacer
atcatcatagtgacgataatcttcaagtgaatt	Protospacer
 ***********  *************..**

60. spacer 1.109|166607|33|NZ_CP041280|CRT,PILER-CR matches to GU071098 (Synechococcus phage S-SSM7, complete genome) position: , mismatch: 7, identity: 0.788 

ttcatcatagtgtggataatcttcaagcaaaga	CRISPR spacer
atcatcatagtgacgataatcttcaagtgaatt	Protospacer
 ***********  *************..**

61. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to MF775693 (Lactococcus phage LP0209, complete genome) position: , mismatch: 7, identity: 0.788 

tcgacttgaccgaagaagaaaaagaa---ggagtca	CRISPR spacer
ccgacttgacagaagaacaaaaagaacttgaag---	Protospacer
.********* ****** ********   *.**

62. spacer 1.118|167156|33|NZ_CP041280|CRT,PILER-CR matches to MF417959 (Uncultured Caudovirales phage clone 2F_5, partial genome) position: , mismatch: 7, identity: 0.788 

ccgaaaatatcgatgttgttcgtcaaatagata	CRISPR spacer
cgttaaatatagatgttgttcgtaaaataacta	Protospacer
*   ****** ************ *****. **

63. spacer 1.5|163923|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgacggcaatttttacggggcatcttgccta	CRISPR spacer
cagttggcgatgtttacggggcatcttgctcg	Protospacer
* * .***.** *****************...

64. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
cgccacctccaggtgccgatgtcgtcgccgtc	Protospacer
. * *  ***** ****** ***********

65. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgaag----tccagttgccgaagtcgtcgccgtg	CRISPR spacer
----aggacgcgccagtcgccgaagtggtcgccgtg	Protospacer
    *.*     *****.******** *********

66. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75 

tccga--agtccagttgccgaagtcgtcgccgtg	CRISPR spacer
--cgatcgcaccagttgccgaagccatcgccgtc	Protospacer
  ***  .  *************.*.*******

67. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75 

tccga--agtccagttgccgaagtcgtcgccgtg	CRISPR spacer
--cgatcgcaccagttgccgaagccatcgccgtc	Protospacer
  ***  .  *************.*.*******

68. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
cgccacctccaggtgccgatgtcgtcgccgtc	Protospacer
. * *  ***** ****** ***********

69. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgaag----tccagttgccgaagtcgtcgccgtg	CRISPR spacer
----aggacgcgccagtcgccgaagtggtcgccgtg	Protospacer
    *.*     *****.******** *********

70. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75 

tccga--agtccagttgccgaagtcgtcgccgtg	CRISPR spacer
--cgatcgcaccagttgccgaagccatcgccgtc	Protospacer
  ***  .  *************.*.*******

71. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75 

tccga--agtccagttgccgaagtcgtcgccgtg	CRISPR spacer
--cgatcgcaccagttgccgaagccatcgccgtc	Protospacer
  ***  .  *************.*.*******

72. spacer 1.34|165692|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 8, identity: 0.75 

taacggccgcctgggccttctgttgctggtta	CRISPR spacer
caaccgccgcctgggcctgctgttgagcgatg	Protospacer
.*** ************* ******   * *.

73. spacer 1.34|165692|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

taacggccgcctgggccttctgttgctggtta	CRISPR spacer
caaccgccgcctgggcctgctgttgagcgatg	Protospacer
.*** ************* ******   * *.

74. spacer 1.34|165692|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

taacggccgcctgggccttctgttgctggtta	CRISPR spacer
caaccgccgcctgggcctgctgttgagcgatg	Protospacer
.*** ************* ******   * *.

75. spacer 1.42|166180|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP043057 (Dolichospermum sp. UHCC 0315A plasmid pUHCC0315a, complete sequence) position: , mismatch: 8, identity: 0.75 

gaagcttat---gtcgctctgctaccagctcccga	CRISPR spacer
---acctgtgaagtcgcactgctaccaggtcccga	Protospacer
   .*.*.*   ***** ********** ******

76. spacer 1.42|166180|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP043058 (Dolichospermum sp. UHCC 0315A plasmid pUHCC0315b, complete sequence) position: , mismatch: 8, identity: 0.75 

gaagcttat---gtcgctctgctaccagctcccga	CRISPR spacer
---acctgtgaagtcgcactgctaccaggtcccga	Protospacer
   .*.*.*   ***** ********** ******

77. spacer 1.45|166363|32|NZ_CP041280|CRISPRCasFinder matches to MK415407 (Phage FAKO27_000271F, complete genome) position: , mismatch: 8, identity: 0.75 

acgcgtgaaattggcgaattcatttgggacgg	CRISPR spacer
ttaagaaaacttggcaaattcatttgggacgg	Protospacer
 .. * .** *****.****************

78. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to MF775693 (Lactococcus phage LP0209, complete genome) position: , mismatch: 8, identity: 0.75 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ccgacttgacagaagaacaaaaagaacttgaa	Protospacer
.********* ****** ********   *

79. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 8, identity: 0.75 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tcgacttgacccaagaagagaaagagcacggt	Protospacer
*********** *******.*****. . * .

80. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_049397 (Lactococcus phage 05601, complete genome) position: , mismatch: 8, identity: 0.75 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagaactagaa	Protospacer
..******** ****** ********  **

81. spacer 1.59|167217|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 8, identity: 0.75 

tcaaattaaaacacatattcagaaataacatc	CRISPR spacer
cccctttaaaaaacatattcagaaataacgaa	Protospacer
.*   ****** *****************.

82. spacer 1.59|167217|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP018682 (Vibrio casei strain DSM 22364 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcaaattaaaacacatattcagaaataacatc	CRISPR spacer
ggcaattaaaacaaataatcagaaataaaaag	Protospacer
   ********** *** ********** *

83. spacer 1.59|167217|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP018688 (Vibrio rumoiensis strain FERM P-14531 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcaaattaaaacacatattcagaaataacatc	CRISPR spacer
ggcaattaaaacaaataatcagaaataaaaag	Protospacer
   ********** *** ********** *

84. spacer 1.59|167217|32|NZ_CP041280|CRISPRCasFinder matches to HQ634175 (Cyanophage P-RSM1 genomic sequence) position: , mismatch: 8, identity: 0.75 

tcaaattaaaacacatattcagaaataacatc-	CRISPR spacer
acaaattaagacagatattcag-aacggaatca	Protospacer
 ********.*** ******** **... ***

85. spacer 1.70|164228|33|NZ_CP041280|PILER-CR,CRT matches to NC_041877 (Pseudomonas phage SM1, complete genome) position: , mismatch: 8, identity: 0.758 

ccagtcagtccggactttgcgtaggttggctca	CRISPR spacer
acggagaatctggactttgcgcaggttggctcg	Protospacer
 *.*  *.**.**********.**********.

86. spacer 1.70|164228|33|NZ_CP041280|PILER-CR,CRT matches to JQ067090 (UNVERIFIED: Pseudomonas phage PaMx31, partial genome) position: , mismatch: 8, identity: 0.758 

ccagtcagtccggactttgcgtaggttggctca	CRISPR spacer
acggagaatctggactttgcgcaggttggctcg	Protospacer
 *.*  *.**.**********.**********.

87. spacer 1.74|164472|33|NZ_CP041280|PILER-CR,CRT matches to NC_001949 (Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence) position: , mismatch: 8, identity: 0.758 

agtttttcttaaattcttgttcagtagtcatta	CRISPR spacer
agtttattttaaattcttgttcagggtggttta	Protospacer
***** *.**************** .    ***

88. spacer 1.74|164472|33|NZ_CP041280|PILER-CR,CRT matches to MN693865 (Marine virus AFVG_250M332, complete genome) position: , mismatch: 8, identity: 0.758 

agtttttcttaaattcttgttcagtagtcatta	CRISPR spacer
attgcatattaaattgttgttcaggagtcattc	Protospacer
* * . * ******* ******** *******

89. spacer 1.76|164594|33|NZ_CP041280|PILER-CR,CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.758 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
cgccacctccaggtgccgatgtcgtcgccgtcg	Protospacer
. * *  ***** ****** *********** *

90. spacer 1.81|164899|33|NZ_CP041280|CRT matches to NC_041877 (Pseudomonas phage SM1, complete genome) position: , mismatch: 8, identity: 0.758 

ccagtcagtccggactttgcgtaggttggctca	CRISPR spacer
acggagaatctggactttgcgcaggttggctcg	Protospacer
 *.*  *.**.**********.**********.

91. spacer 1.81|164899|33|NZ_CP041280|CRT matches to JQ067090 (UNVERIFIED: Pseudomonas phage PaMx31, partial genome) position: , mismatch: 8, identity: 0.758 

ccagtcagtccggactttgcgtaggttggctca	CRISPR spacer
acggagaatctggactttgcgcaggttggctcg	Protospacer
 *.*  *.**.**********.**********.

92. spacer 1.85|165143|33|NZ_CP041280|CRT matches to NC_001949 (Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence) position: , mismatch: 8, identity: 0.758 

agtttttcttaaattcttgttcagtagtcatta	CRISPR spacer
agtttattttaaattcttgttcagggtggttta	Protospacer
***** *.**************** .    ***

93. spacer 1.85|165143|33|NZ_CP041280|CRT matches to MN693865 (Marine virus AFVG_250M332, complete genome) position: , mismatch: 8, identity: 0.758 

agtttttcttaaattcttgttcagtagtcatta	CRISPR spacer
attgcatattaaattgttgttcaggagtcattc	Protospacer
* * . * ******* ******** *******

94. spacer 1.87|165265|33|NZ_CP041280|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.758 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
cgccacctccaggtgccgatgtcgtcgccgtcg	Protospacer
. * *  ***** ****** *********** *

95. spacer 1.102|166180|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP043057 (Dolichospermum sp. UHCC 0315A plasmid pUHCC0315a, complete sequence) position: , mismatch: 8, identity: 0.758 

gaagcttat---gtcgctctgctaccagctcccgaa	CRISPR spacer
---acctgtgaagtcgcactgctaccaggtcccgaa	Protospacer
   .*.*.*   ***** ********** *******

96. spacer 1.102|166180|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP043058 (Dolichospermum sp. UHCC 0315A plasmid pUHCC0315b, complete sequence) position: , mismatch: 8, identity: 0.758 

gaagcttat---gtcgctctgctaccagctcccgaa	CRISPR spacer
---acctgtgaagtcgcactgctaccaggtcccgaa	Protospacer
   .*.*.*   ***** ********** *******

97. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NZ_LT598658 (Legionella pneumophila strain Lpm7613 isolate Lpm7613 plasmid 2) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagagt	Protospacer
*   ***.*******************.**

98. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NZ_LN681226 (Legionella hackeliae strain ATCC 35250 plasmid II, complete sequence) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagagt	Protospacer
*   ***.*******************.**

99. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP021287 (Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagagt	Protospacer
*   ***.*******************.**

100. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NC_006365 (Legionella pneumophila str. Paris plasmid pLPP, complete sequence) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagagt	Protospacer
*   ***.*******************.**

101. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP021282 (Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagagt	Protospacer
*   ***.*******************.**

102. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP016031 (Legionella pneumophila strain OLDA plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tattcttaaccgaagaagaaaaagaagaagagt	Protospacer
*   ***.*******************.**

103. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to DQ054536 (Lactococcus phage P008, complete genome) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaa---ggagtca	CRISPR spacer
ctgacttgacagaagaacaaaaagaacttgaag---	Protospacer
..******** ****** ********   *.**

104. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NC_049370 (Lactococcus phage 936 group phage PhiS0139, complete genome) position: , mismatch: 8, identity: 0.758 

tcgacttgaccgaagaagaaaaagaa---ggagtca	CRISPR spacer
ctgacttgacagaagaacaaaaagaacttgaag---	Protospacer
..******** ****** ********   *.**

105. spacer 1.12|164350|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.719 

cctggagtgtcagctctctcatgcgcaagaaa	CRISPR spacer
cggggagtgtcagttcactcatgcgcgggtgc	Protospacer
*  **********.** *********..* .

106. spacer 1.14|164472|32|NZ_CP041280|CRISPRCasFinder matches to MN693975 (Marine virus AFVG_250M1117, complete genome) position: , mismatch: 9, identity: 0.719 

agtttttcttaaattcttgttcagtagtcatt	CRISPR spacer
aattattattaaattcttgttcagtttttgga	Protospacer
*.** ** *****************  *..

107. spacer 1.15|164533|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 9, identity: 0.719 

catgactgctccttaaataaaaaggcttgtag	CRISPR spacer
catgattgctccttaaacaaaaataaccattg	Protospacer
*****.***********.***** . ...* *

108. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

109. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

110. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

111. spacer 1.16|164594|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

112. spacer 1.23|165021|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.719 

cctggagtgtcagctctctcatgcgcaagaaa	CRISPR spacer
cggggagtgtcagttcactcatgcgcgggtgc	Protospacer
*  **********.** *********..* .

113. spacer 1.25|165143|32|NZ_CP041280|CRISPRCasFinder matches to MN693975 (Marine virus AFVG_250M1117, complete genome) position: , mismatch: 9, identity: 0.719 

agtttttcttaaattcttgttcagtagtcatt	CRISPR spacer
aattattattaaattcttgttcagtttttgga	Protospacer
*.** ** *****************  *..

114. spacer 1.26|165204|32|NZ_CP041280|CRISPRCasFinder matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 9, identity: 0.719 

catgactgctccttaaataaaaaggcttgtag	CRISPR spacer
catgattgctccttaaacaaaaataaccattg	Protospacer
*****.***********.***** . ...* *

115. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

116. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

117. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

118. spacer 1.27|165265|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tccgaagtccagttgccgaagtcgtcgccgtg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtg	Protospacer
*    . * *********  ************

119. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_KU525621 (Bacillus anthracis strain P.NO2 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

120. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NC_014332 (Bacillus cereus biovar anthracis str. CI plasmid pCI-XO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

121. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NC_012577 (Bacillus anthracis str. CDC 684 plasmid pX02, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

122. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP015778 (Bacillus anthracis strain Tangail-1 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

123. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP018905 (Bacillus anthracis strain Tyrol 4675 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

124. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP023003 (Bacillus anthracis strain 14RA5914 plasmid pX02, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

125. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP019733 (Bacillus anthracis strain PCr plasmid PCr-pXO2) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

126. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP018445 (Bacillus anthracis strain CZC5 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

127. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP029325 (Bacillus anthracis strain 17OD930 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

128. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NC_012655 (Bacillus anthracis str. A0248 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

129. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NC_007323 (Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

130. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP010854 (Bacillus anthracis strain A1144 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

131. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP007617 (Bacillus anthracis strain 2000031021 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

132. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP008848 (Bacillus anthracis strain HYU01 plasmid pX02, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

133. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP006744 (Bacillus anthracis str. SVA11 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

134. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP014835 (Bacillus anthracis strain Shikan-NIID plasmid pXO2) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

135. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP029807 (Bacillus anthracis strain London_499 plasmid pX02, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

136. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NC_002146 (Bacillus anthracis plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

137. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NC_017727 (Bacillus anthracis str. H9401 plasmid BAP2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

138. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009314 (Bacillus anthracis str. Turkey32 strain 35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

139. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP014178 (Bacillus anthracis strain Stendal plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

140. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009475 (Bacillus anthracis strain Pasteur plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

141. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009900 (Bacillus anthracis strain 2002013094 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

142. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009339 (Bacillus anthracis strain Ohio ACB plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

143. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009695 (Bacillus anthracis strain RA3 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

144. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009462 (Bacillus anthracis strain SK-102 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

145. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009698 (Bacillus anthracis strain BA1035 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

146. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009542 (Bacillus anthracis strain BA1015 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

147. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP010320 (Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

148. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009329 (Bacillus anthracis strain K3 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

149. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009326 (Bacillus anthracis strain Vollum 1B plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

150. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP009979 (Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

151. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP001972 (Bacillus anthracis str. A16 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

152. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP047133 (Bacillus anthracis str. BF1 plasmid pXO2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
gctgccgcaatttcttcccggactgatacaat	Protospacer
** *********** ********.  . ** .

153. spacer 1.49|166607|32|NZ_CP041280|CRISPRCasFinder matches to MH319726 (Marine virus AG-345-D19 Ga0172267_107 genomic sequence) position: , mismatch: 9, identity: 0.719 

ttcatcatagtgtggataatcttcaagcaaag	CRISPR spacer
cctagtttcgtgtggataatctgcaaacaaag	Protospacer
...* . * ************* ***.*****

154. spacer 1.49|166607|32|NZ_CP041280|CRISPRCasFinder matches to KY744240 (Weissella phage PWc, complete genome) position: , mismatch: 9, identity: 0.719 

ttcatcatagtgtggataatcttcaagcaaag	CRISPR spacer
accatcatagtctggataatctacataatatg	Protospacer
 .********* ********** ** .  * *

155. spacer 1.51|166729|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP019447 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence) position: , mismatch: 9, identity: 0.719 

cctttagctcttcggcgaacgcttcgctttcc	CRISPR spacer
cggctcaagcttcggctgacgcttcgctttcc	Protospacer
*  .* .  ******* .**************

156. spacer 1.52|166790|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tgtgtgatcgaagtgcgcaagttcaccaccct	CRISPR spacer
aaccgcatcgaagcgcgcaagttcacccccat	Protospacer
 ..   *******.************* ** *

157. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to DQ054536 (Lactococcus phage P008, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagaacttgaa	Protospacer
..******** ****** ********   *

158. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to KF676640 (Lactococcus phage SK1833, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaa	Protospacer
.********* ****** *******.  .*

159. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_001835 (Lactococcus phage sk1, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaa	Protospacer
.********* ****** *******.  .*

160. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to GQ979703 (Lactococcus lactis phage p2, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaa	Protospacer
.********* ****** *******.  .*

161. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to MF448567 (Lactococcus phage 66901, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagaactggaa	Protospacer
..******** ****** ********  .*

162. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_049370 (Lactococcus phage 936 group phage PhiS0139, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagaacttgaa	Protospacer
..******** ****** ********   *

163. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to AF011378 (Bacteriophage sk1 complete genome) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaa	Protospacer
.********* ****** *******.  .*

164. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_KU356480 (Vibrio parahaemolyticus strain VPS92 plasmid pVPS92-VEB, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tacgtgtaaccgaagaagtaaaagaagaagtt	Protospacer
*  .. *.********** ********.***.

165. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgac--ttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
--aactattaaccgaagaagaaaaagcaggtcaa	Protospacer
  .**  **.**************** ***

166. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP053812 (Vibrio cholerae strain W6G plasmid pW6G, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tacgtgtaaccgaagaagtaaaagaagaagtt	Protospacer
*  .. *.********** ********.***.

167. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP053815 (Vibrio cholerae strain W7G plasmid pW7G, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tacgtgtaaccgaagaagtaaaagaagaagtt	Protospacer
*  .. *.********** ********.***.

168. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
tacgtgtaaccgaagaagtaaaagaagaagtt	Protospacer
*  .. *.********** ********.***.

169. spacer 1.65|163923|33|NZ_CP041280|PILER-CR,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

ctgacggcaatttttacggggcatcttgcctaa	CRISPR spacer
cagttggcgatgtttacggggcatcttgctcgc	Protospacer
* * .***.** *****************...

170. spacer 1.76|164594|33|NZ_CP041280|PILER-CR,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

171. spacer 1.76|164594|33|NZ_CP041280|PILER-CR,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

172. spacer 1.76|164594|33|NZ_CP041280|PILER-CR,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

173. spacer 1.76|164594|33|NZ_CP041280|PILER-CR,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

174. spacer 1.76|164594|33|NZ_CP041280|PILER-CR,CRT matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaag----tccagttgccgaagtcgtcgccgtgg	CRISPR spacer
----aggacgcgccagtcgccgaagtggtcgccgtgc	Protospacer
    *.*     *****.******** *********

175. spacer 1.87|165265|33|NZ_CP041280|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

176. spacer 1.87|165265|33|NZ_CP041280|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

177. spacer 1.87|165265|33|NZ_CP041280|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

178. spacer 1.87|165265|33|NZ_CP041280|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaagtccagttgccgaagtcgtcgccgtgg	CRISPR spacer
tggccgctgcagttgccgctgtcgtcgccgtgg	Protospacer
*    . * *********  *************

179. spacer 1.87|165265|33|NZ_CP041280|CRT matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 9, identity: 0.727 

tccgaag----tccagttgccgaagtcgtcgccgtgg	CRISPR spacer
----aggacgcgccagtcgccgaagtggtcgccgtgc	Protospacer
    *.*     *****.******** *********

180. spacer 1.94|165692|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 9, identity: 0.727 

taacggccgcctgggccttctgttgctggttaa	CRISPR spacer
caaccgccgcctgggcctgctgttgagcgatgc	Protospacer
.*** ************* ******   * *.

181. spacer 1.94|165692|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

taacggccgcctgggccttctgttgctggttaa	CRISPR spacer
caaccgccgcctgggcctgctgttgagcgatgc	Protospacer
.*** ************* ******   * *.

182. spacer 1.94|165692|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taacggccgcctgggccttctgttgctggttaa	CRISPR spacer
caaccgccgcctgggcctgctgttgagcgatgc	Protospacer
.*** ************* ******   * *.

183. spacer 1.105|166363|33|NZ_CP041280|CRT,PILER-CR matches to MK415407 (Phage FAKO27_000271F, complete genome) position: , mismatch: 9, identity: 0.727 

acgcgtgaaattggcgaattcatttgggacggg	CRISPR spacer
ttaagaaaacttggcaaattcatttgggacggc	Protospacer
 .. * .** *****.****************

184. spacer 1.111|166729|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP019447 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-2, complete sequence) position: , mismatch: 9, identity: 0.727 

cctttagctcttcggcgaacgcttcgctttcca	CRISPR spacer
cggctcaagcttcggctgacgcttcgctttcca	Protospacer
*  .* .  ******* .***************

185. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 9, identity: 0.727 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
tcgacttgacccaagaagagaaagagcacggtg	Protospacer
*********** *******.*****. . * ..

186. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NC_049397 (Lactococcus phage 05601, complete genome) position: , mismatch: 9, identity: 0.727 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
ctgacttgacagaagaacaaaaagaactagaag	Protospacer
..******** ****** ********  **  .

187. spacer 1.119|167217|33|NZ_CP041280|CRT,PILER-CR matches to EU409559 (Lactobacillus phage JCL1032, complete genome) position: , mismatch: 9, identity: 0.727 

tcaaattaaaacacatattcagaaataacatca	CRISPR spacer
cccctttaaaaaacatattcagaaataacgaag	Protospacer
.*   ****** *****************.  .

188. spacer 1.119|167217|33|NZ_CP041280|CRT,PILER-CR matches to NZ_AP018682 (Vibrio casei strain DSM 22364 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727 

tcaaattaaaacacatattcagaaataacatca	CRISPR spacer
ggcaattaaaacaaataatcagaaataaaaagt	Protospacer
   ********** *** ********** *

189. spacer 1.119|167217|33|NZ_CP041280|CRT,PILER-CR matches to NZ_AP018688 (Vibrio rumoiensis strain FERM P-14531 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.727 

tcaaattaaaacacatattcagaaataacatca	CRISPR spacer
ggcaattaaaacaaataatcagaaataaaaagt	Protospacer
   ********** *** ********** *

190. spacer 1.43|166241|32|NZ_CP041280|CRISPRCasFinder matches to KJ081346 (Bacillus phage BCP8-2, complete genome) position: , mismatch: 10, identity: 0.688 

tgggctttttccttacgctcttaattatactc	CRISPR spacer
ctgttgcttttcttacgctcataattatacct	Protospacer
. * . .***.********* *********..

191. spacer 1.43|166241|32|NZ_CP041280|CRISPRCasFinder matches to NC_027352 (Bacillus phage JBP901, complete genome) position: , mismatch: 10, identity: 0.688 

tgggctttttccttacgctcttaattatactc	CRISPR spacer
ctgttgcttttcttacgctcataattatacct	Protospacer
. * . .***.********* *********..

192. spacer 1.43|166241|32|NZ_CP041280|CRISPRCasFinder matches to MG602477 (Bacillus phage BCP01, complete genome) position: , mismatch: 10, identity: 0.688 

tgggctttttccttacgctcttaattatactc	CRISPR spacer
cagttgcttttcttacgctcataattatacct	Protospacer
..* . .***.********* *********..

193. spacer 1.43|166241|32|NZ_CP041280|CRISPRCasFinder matches to KX495186 (Bacillus phage PK16, complete genome) position: , mismatch: 10, identity: 0.688 

tgggctttttccttacgctcttaattatactc	CRISPR spacer
cagttgcttttcttacgctcataattatacct	Protospacer
..* . .***.********* *********..

194. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.688 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
tcttccgcaatctcgtcccgcacctccagcaa	Protospacer
 *  *******.******** ******

195. spacer 1.51|166729|32|NZ_CP041280|CRISPRCasFinder matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 10, identity: 0.688 

cctttagctcttcggcgaacgcttcgctttcc	CRISPR spacer
tgccctgctcttcggcgaacgccgcgcttgcg	Protospacer
. ... ****************. ***** *

196. spacer 1.51|166729|32|NZ_CP041280|CRISPRCasFinder matches to MH248138 (Erwinia phage vB_EamM_Alexandra, complete genome) position: , mismatch: 10, identity: 0.688 

cctttagctcttcggcgaacgcttcgctttcc	CRISPR spacer
acgcagtttcttcggagtacgcttcgctttcg	Protospacer
 * . . .******* * *************

197. spacer 1.51|166729|32|NZ_CP041280|CRISPRCasFinder matches to MH460463 (Dickeya phage vB_DsoM_AD1, complete genome) position: , mismatch: 10, identity: 0.688 

cctttagctcttcggcgaacgcttcgctttcc	CRISPR spacer
acgcagtttcttcggtgtacgcttcgctttcg	Protospacer
 * . . .*******.* *************

198. spacer 1.52|166790|32|NZ_CP041280|CRISPRCasFinder matches to KT919973 (Vibrio phage phi-ST2, complete genome) position: , mismatch: 10, identity: 0.688 

tgtgtgatcgaagtgcgcaagttcaccaccct	CRISPR spacer
gattgcatcgaagttcgcaggttcaccacgac	Protospacer
 .*   ******** ****.*********  .

199. spacer 1.54|166912|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP008877 (Terribacillus goriensis strain MP602 plasmid pT1, complete sequence) position: , mismatch: 10, identity: 0.688 

tctaaaaagtcttgtatttccaacggaaacat	CRISPR spacer
actaaaaagtgttgaatttccaacctggtcta	Protospacer
 ********* *** *********  .. *

200. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_008371 (Lactococcus phage jj50, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagagctggaa	Protospacer
..******** ****** *******.  .*

201. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_010363 (Lactococcus phage asccphi28, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgaattaaccgaagaagaaaaagagtattta	Protospacer
..** **.*****************. .  *

202. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to MF448563 (Lactococcus phage 57001, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagagctggaa	Protospacer
..******** ****** *******.  .*

203. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to NC_049414 (Lactococcus phage 96403, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagagctggaa	Protospacer
..******** ****** *******.  .*

204. spacer 1.55|166973|32|NZ_CP041280|CRISPRCasFinder matches to DQ227764 (Lactococcus lactis phage jj50, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacttgaccgaagaagaaaaagaaggagtc	CRISPR spacer
ctgacttgacagaagaacaaaaagagctggaa	Protospacer
..******** ****** *******.  .*

205. spacer 1.59|167217|32|NZ_CP041280|CRISPRCasFinder matches to MT648819 (Acinetobacter phage C001, partial genome) position: , mismatch: 10, identity: 0.688 

tcaaattaaaacacatattcagaaataacatc	CRISPR spacer
tttttttaaaacctatattcagaaataaacct	Protospacer
*.   ******* .**************  ..

206. spacer 1.112|166790|33|NZ_CP041280|CRT,PILER-CR matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697 

tgtgtgatcgaagtgcgcaagttcaccaccctg	CRISPR spacer
aaccgcatcgaagcgcgcaagttcacccccatc	Protospacer
 ..   *******.************* ** *

207. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to KF676640 (Lactococcus phage SK1833, complete genome) position: , mismatch: 10, identity: 0.697 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaag	Protospacer
.********* ****** *******.  .*  .

208. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to NC_001835 (Lactococcus phage sk1, complete genome) position: , mismatch: 10, identity: 0.697 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaag	Protospacer
.********* ****** *******.  .*  .

209. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to GQ979703 (Lactococcus lactis phage p2, complete genome) position: , mismatch: 10, identity: 0.697 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaag	Protospacer
.********* ****** *******.  .*  .

210. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to MF448567 (Lactococcus phage 66901, complete genome) position: , mismatch: 10, identity: 0.697 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
ctgacttgacagaagaacaaaaagaactggaag	Protospacer
..******** ****** ********  .*  .

211. spacer 1.115|166973|33|NZ_CP041280|CRT,PILER-CR matches to AF011378 (Bacteriophage sk1 complete genome) position: , mismatch: 10, identity: 0.697 

tcgacttgaccgaagaagaaaaagaaggagtca	CRISPR spacer
ccgacttgacagaagaacaaaaagagctggaag	Protospacer
.********* ****** *******.  .*  .

212. spacer 1.14|164472|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP026415 (Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence) position: , mismatch: 11, identity: 0.656 

agtttttcttaaattcttgttcagtagtcatt	CRISPR spacer
ttcttttcttaaattcattttcagtaaattgc	Protospacer
  .************* * *******. .  .

213. spacer 1.25|165143|32|NZ_CP041280|CRISPRCasFinder matches to NZ_CP026415 (Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence) position: , mismatch: 11, identity: 0.656 

agtttttcttaaattcttgttcagtagtcatt	CRISPR spacer
ttcttttcttaaattcattttcagtaaattgc	Protospacer
  .************* * *******. .  .

214. spacer 1.48|166546|32|NZ_CP041280|CRISPRCasFinder matches to NZ_LR723671 (Rhizobium flavum strain YW14 plasmid 2) position: , mismatch: 11, identity: 0.656 

gcggccgcaatttcgtcccggacctcctcatc	CRISPR spacer
cgctttgcaatttcgtcgcggacctcttccag	Protospacer
    ..*********** ********.**

215. spacer 1.51|166729|32|NZ_CP041280|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.656 

cctttagctcttcggcgaacgcttcgctttcc	CRISPR spacer
ttcgtagcgcttcggcgaacgctccgcgagtt	Protospacer
... **** **************.***   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 345775 : 386828 47 Lactobacillus_phage(66.67%) holin,terminase,portal,integrase attL 346290:346304|attR 386999:387013
DBSCAN-SWA_2 736274 : 745077 9 Phaeocystis_globosa_virus(33.33%) NA NA
DBSCAN-SWA_3 1005054 : 1013134 8 Lactobacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 1145153 : 1150944 7 Streptomyces_phage(42.86%) NA NA
DBSCAN-SWA_5 1592077 : 1600649 8 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1746471 : 1815747 48 Streptococcus_phage(22.22%) tRNA,protease,transposase,integrase attL 1789617:1789670|attR 1805931:1805984

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage