Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP019746 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA6, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019741 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA1, complete sequence 0 crisprs DinG 0 0 0 0
NZ_AP019747 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA7, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 1 crisprs WYL,csa3 1 1 1 1
NZ_AP019748 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA8, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019740 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 1 crisprs WYL,cas3,csa3,cas3f,cas8f,cas5f,cas7f,cas1,DEDDh 0 46 4 0
NZ_AP019745 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA5, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019744 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA4, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP019743 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AP019740
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019740_1 1775687-1779254 TypeI-F NA
59 spacers
cas1,cas7f,cas5f,cas8f,cas3f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP019740_1 1.72|1776495|32|NZ_AP019740|CRISPRCasFinder 1776495-1776526 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 10064-10095 0 1.0
NZ_AP019740_1 1.14|1776494|33|NZ_AP019740|PILER-CR,CRT 1776494-1776526 33 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 10063-10095 1 0.97
NZ_AP019740_1 1.110|1778775|32|NZ_AP019740|CRISPRCasFinder 1778775-1778806 32 MF417988 Uncultured Caudovirales phage clone 2AX_4, partial genome 3206-3237 1 0.969
NZ_AP019740_1 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder 1778955-1778986 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 36605-36636 1 0.969
NZ_AP019740_1 1.52|1778774|33|NZ_AP019740|PILER-CR,CRT 1778774-1778806 33 MF417988 Uncultured Caudovirales phage clone 2AX_4, partial genome 3206-3238 2 0.939
NZ_AP019740_1 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT 1778954-1778986 33 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 36605-36637 2 0.939
NZ_AP019740_1 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder 1776255-1776286 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 38287-38318 2 0.938
NZ_AP019740_1 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder 1778955-1778986 32 MF417906 Uncultured Caudovirales phage clone 7F_8, partial genome 35088-35119 2 0.938
NZ_AP019740_1 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder 1778955-1778986 32 MF417894 Uncultured Caudovirales phage clone 7AX_4, partial genome 5642-5673 2 0.938
NZ_AP019740_1 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder 1778955-1778986 32 MF417905 Uncultured Caudovirales phage clone 8AX_11, partial genome 35110-35141 2 0.938
NZ_AP019740_1 1.10|1776254|33|NZ_AP019740|PILER-CR,CRT 1776254-1776286 33 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 38286-38318 3 0.909
NZ_AP019740_1 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT 1778954-1778986 33 MF417894 Uncultured Caudovirales phage clone 7AX_4, partial genome 5642-5674 3 0.909
NZ_AP019740_1 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT 1778954-1778986 33 MF417906 Uncultured Caudovirales phage clone 7F_8, partial genome 35087-35119 3 0.909
NZ_AP019740_1 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT 1778954-1778986 33 MF417905 Uncultured Caudovirales phage clone 8AX_11, partial genome 35109-35141 3 0.909
NZ_AP019740_1 1.60|1775775|32|NZ_AP019740|CRISPRCasFinder 1775775-1775806 32 CP019144 Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence 84349-84380 5 0.844
NZ_AP019740_1 1.60|1775775|32|NZ_AP019740|CRISPRCasFinder 1775775-1775806 32 CP019144 Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence 163024-163055 5 0.844
NZ_AP019740_1 1.2|1775774|33|NZ_AP019740|PILER-CR,CRT 1775774-1775806 33 CP019144 Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence 84348-84380 6 0.818
NZ_AP019740_1 1.2|1775774|33|NZ_AP019740|PILER-CR,CRT 1775774-1775806 33 CP019144 Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence 163024-163056 6 0.818
NZ_AP019740_1 1.57|1779074|33|NZ_AP019740|PILER-CR,CRT 1779074-1779106 33 NZ_CP043858 Arcobacter cibarius strain H743 plasmid pACIB, complete sequence 187395-187427 6 0.818
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 MH319754 Marine virus AG-345-L05 Ga0172272_11 genomic sequence 9101-9132 6 0.812
NZ_AP019740_1 1.114|1779015|32|NZ_AP019740|CRISPRCasFinder 1779015-1779046 32 MK249308 Salmonella phage TS13, complete genome 26133-26164 6 0.812
NZ_AP019740_1 1.114|1779015|32|NZ_AP019740|CRISPRCasFinder 1779015-1779046 32 KY014601 Escherichia phage Utah, complete genome 26002-26033 6 0.812
NZ_AP019740_1 1.63|1775955|32|NZ_AP019740|CRISPRCasFinder 1775955-1775986 32 NC_025249 Lactococcus lactis subsp. cremoris MG1363 plasmid pFI430, complete sequence 56784-56815 7 0.781
NZ_AP019740_1 1.91|1777635|32|NZ_AP019740|CRISPRCasFinder 1777635-1777666 32 MG592611 Vibrio phage 1.246.O._10N.261.54.E10, partial genome 7700-7731 7 0.781
NZ_AP019740_1 1.98|1778055|32|NZ_AP019740|CRISPRCasFinder 1778055-1778086 32 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 138917-138948 7 0.781
NZ_AP019740_1 1.98|1778055|32|NZ_AP019740|CRISPRCasFinder 1778055-1778086 32 MK679546 Phage AS32, partial genome 35670-35701 7 0.781
NZ_AP019740_1 1.104|1778415|32|NZ_AP019740|CRISPRCasFinder 1778415-1778446 32 MG592458 Vibrio phage 1.083.O._10N.286.52.B9, partial genome 39615-39646 7 0.781
NZ_AP019740_1 1.104|1778415|32|NZ_AP019740|CRISPRCasFinder 1778415-1778446 32 MG592666 Vibrio phage 2.096.O._10N.286.48.B5, partial genome 39669-39700 7 0.781
NZ_AP019740_1 1.105|1778475|32|NZ_AP019740|CRISPRCasFinder 1778475-1778506 32 CP031730 Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence 32994-33025 7 0.781
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 MN694501 Marine virus AFVG_250M1038, complete genome 6804-6835 7 0.781
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 MN694086 Marine virus AFVG_250M1072, complete genome 34383-34414 7 0.781
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 NC_007110 Rickettsia felis URRWXCal2 plasmid pRF, complete sequence 27809-27840 7 0.781
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 NC_019229 Rickettsia felis plasmid pRF, complete sequence 27838-27869 7 0.781
NZ_AP019740_1 1.114|1779015|32|NZ_AP019740|CRISPRCasFinder 1779015-1779046 32 NC_014755 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU02, complete sequence 68315-68346 7 0.781
NZ_AP019740_1 1.40|1778054|33|NZ_AP019740|PILER-CR,CRT 1778054-1778086 33 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 138916-138948 8 0.758
NZ_AP019740_1 1.40|1778054|33|NZ_AP019740|PILER-CR,CRT 1778054-1778086 33 MK679546 Phage AS32, partial genome 35670-35702 8 0.758
NZ_AP019740_1 1.49|1778594|33|NZ_AP019740|PILER-CR,CRT 1778594-1778626 33 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 301104-301136 8 0.758
NZ_AP019740_1 1.60|1775775|32|NZ_AP019740|CRISPRCasFinder 1775775-1775806 32 NC_015710 Simkania negevensis Z plasmid pSn, complete sequence 24800-24831 8 0.75
NZ_AP019740_1 1.62|1775895|32|NZ_AP019740|CRISPRCasFinder 1775895-1775926 32 NC_019762 Microcoleus sp. PCC 7113 plasmid pMIC7113.07, complete sequence 15590-15621 8 0.75
NZ_AP019740_1 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder 1776255-1776286 32 MN855645 Myoviridae sp. isolate 24, complete genome 5570-5601 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NC_017533 Pantoea ananatis AJ13355 plasmid pEA320, complete sequence 31103-31134 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP017591 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence 127456-127487 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NC_016817 Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence 79517-79548 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP020944 Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence 79582-79613 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP014208 Pantoea ananatis strain R100 plasmid, complete sequence 298002-298033 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 79682-79713 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP049116 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence 89341-89372 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 CP054909 Pantoea ananatis strain FDAARGOS_680 plasmid unnamed1, complete sequence 155331-155362 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP022429 Pantoea ananatis strain YJ76 plasmid p_unamed1 198416-198447 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP035036 Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence 187032-187063 8 0.75
NZ_AP019740_1 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder 1776435-1776466 32 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 47504-47535 8 0.75
NZ_AP019740_1 1.74|1776615|32|NZ_AP019740|CRISPRCasFinder 1776615-1776646 32 NZ_CP049359 Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence 181889-181920 8 0.75
NZ_AP019740_1 1.77|1776795|32|NZ_AP019740|CRISPRCasFinder 1776795-1776826 32 NZ_CP029460 Clostridium novyi strain 150557 plasmid pCN2, complete sequence 15180-15211 8 0.75
NZ_AP019740_1 1.94|1777815|32|NZ_AP019740|CRISPRCasFinder 1777815-1777846 32 MT774408 CrAssphage cr130_1, complete genome 73481-73512 8 0.75
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 237406-237437 8 0.75
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 188529-188560 8 0.75
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 NZ_CP041677 Lactobacillus reuteri strain LL7 plasmid unnamed, complete sequence 30683-30714 8 0.75
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 AP013501 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-U-MedDCM-OCT-S24-C60 1961-1992 8 0.75
NZ_AP019740_1 1.107|1778595|32|NZ_AP019740|CRISPRCasFinder 1778595-1778626 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 301105-301136 8 0.75
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 NZ_CP043858 Arcobacter cibarius strain H743 plasmid pACIB, complete sequence 187395-187426 8 0.75
NZ_AP019740_1 1.116|1779135|32|NZ_AP019740|CRISPRCasFinder 1779135-1779166 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 830223-830254 8 0.75
NZ_AP019740_1 1.12|1776374|33|NZ_AP019740|PILER-CR,CRT 1776374-1776406 33 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 33215-33247 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NC_017533 Pantoea ananatis AJ13355 plasmid pEA320, complete sequence 31103-31135 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP017591 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence 127456-127488 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NC_016817 Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence 79516-79548 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP020944 Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence 79581-79613 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP014208 Pantoea ananatis strain R100 plasmid, complete sequence 298002-298034 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 79681-79713 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP049116 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence 89341-89373 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 CP054909 Pantoea ananatis strain FDAARGOS_680 plasmid unnamed1, complete sequence 155331-155363 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP022429 Pantoea ananatis strain YJ76 plasmid p_unamed1 198415-198447 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP035036 Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence 187032-187064 9 0.727
NZ_AP019740_1 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT 1776434-1776466 33 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 47504-47536 9 0.727
NZ_AP019740_1 1.16|1776614|33|NZ_AP019740|PILER-CR,CRT 1776614-1776646 33 NZ_CP049359 Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence 181888-181920 9 0.727
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_048853 Phage NBEco001, complete genome 32041-32072 9 0.719
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_048855 Phage NBEco002, complete genome 34285-34316 9 0.719
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 AP019559 Escherichia phage SP15 DNA, complete genome 33826-33857 9 0.719
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 AJ604531 Bacteriophage 5 tRNA gene region 7209-7240 9 0.719
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_024139 Escherichia phage vB_EcoS_FFH1, complete genome 33620-33651 9 0.719
NZ_AP019740_1 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder 1776195-1776226 32 MN693100 Marine virus AFVG_25M381, complete genome 4431-4462 9 0.719
NZ_AP019740_1 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder 1776195-1776226 32 MN693190 Marine virus AFVG_25M52, complete genome 30688-30719 9 0.719
NZ_AP019740_1 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder 1776195-1776226 32 MN693373 Marine virus AFVG_25M314, complete genome 30229-30260 9 0.719
NZ_AP019740_1 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder 1776195-1776226 32 MN693273 Marine virus AFVG_25M382, complete genome 4421-4452 9 0.719
NZ_AP019740_1 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder 1776195-1776226 32 MN693247 Marine virus AFVG_25M51, complete genome 30470-30501 9 0.719
NZ_AP019740_1 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder 1776195-1776226 32 MN693503 Marine virus AFVG_25M343, complete genome 4431-4462 9 0.719
NZ_AP019740_1 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder 1776255-1776286 32 NZ_LT670852 Candidatus Erwinia haradaeae strain ErCipseudotaxifoliae isolate 3056 plasmid pl1 13157-13188 9 0.719
NZ_AP019740_1 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder 1776255-1776286 32 NZ_LR217726 Candidatus Erwinia haradaeae strain ErCipseudotaxifoliae isolate 3056 plasmid pBioThi 9061-9092 9 0.719
NZ_AP019740_1 1.70|1776375|32|NZ_AP019740|CRISPRCasFinder 1776375-1776406 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 33216-33247 9 0.719
NZ_AP019740_1 1.77|1776795|32|NZ_AP019740|CRISPRCasFinder 1776795-1776826 32 LT546029 Enterococcus phage VFW genome assembly, chromosome: VFW 20142-20173 9 0.719
NZ_AP019740_1 1.81|1777035|32|NZ_AP019740|CRISPRCasFinder 1777035-1777066 32 NC_010555 Proteus mirabilis HI4320 plasmid pHI4320, complete sequence 512-543 9 0.719
NZ_AP019740_1 1.81|1777035|32|NZ_AP019740|CRISPRCasFinder 1777035-1777066 32 NZ_CP017056 Providencia stuartii strain BE2467 plasmid pPS2, complete sequence 34329-34360 9 0.719
NZ_AP019740_1 1.82|1777095|32|NZ_AP019740|CRISPRCasFinder 1777095-1777126 32 NC_019739 Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence 4877-4908 9 0.719
NZ_AP019740_1 1.88|1777455|32|NZ_AP019740|CRISPRCasFinder 1777455-1777486 32 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 567807-567838 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MK907268 Escherichia phage vB_EcoS-26175II, complete genome 109815-109846 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MK907271 Escherichia phage vB_EcoS-26175V, complete genome 111254-111285 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MK907269 Escherichia phage vB_EcoS-26175III, complete genome 5578-5609 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MT833283 Escherichia coli phage vB_EcoS_Ace, complete genome 13553-13584 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MK907267 Escherichia phage vB_EcoS-26175I, complete genome 42895-42926 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MK907270 Escherichia phage vB_EcoS-26175IV, complete genome 60769-60800 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MN994501 Phage NBSal002, complete genome 105781-105812 9 0.719
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 MH370375 Salmonella phage S124, complete genome 97392-97423 9 0.719
NZ_AP019740_1 1.91|1777635|32|NZ_AP019740|CRISPRCasFinder 1777635-1777666 32 MK448709 Streptococcus phage Javan231, complete genome 23548-23579 9 0.719
NZ_AP019740_1 1.91|1777635|32|NZ_AP019740|CRISPRCasFinder 1777635-1777666 32 MK448710 Streptococcus phage Javan233, complete genome 23548-23579 9 0.719
NZ_AP019740_1 1.93|1777755|32|NZ_AP019740|CRISPRCasFinder 1777755-1777786 32 NC_042100 Vibrio phage Aphrodite1, complete genome 226077-226108 9 0.719
NZ_AP019740_1 1.100|1778175|32|NZ_AP019740|CRISPRCasFinder 1778175-1778206 32 MN693904 Marine virus AFVG_250M977, complete genome 27956-27987 9 0.719
NZ_AP019740_1 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder 1778535-1778566 32 NZ_CP033788 Bacillus sp. FDAARGOS_527 plasmid unnamed1, complete sequence 1927-1958 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MN693048 Marine virus AFVG_25M535, complete genome 25785-25816 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MF360958 Salicola phage SCTP-2, complete genome 143247-143278 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 NC_048084 Lactobacillus phage Iacchus, complete genome 38316-38347 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MH809531 Lactobacillus phage Bromius, complete genome 41103-41134 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MK250016 Prevotella phage Lak-A1, complete genome 152337-152368 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MK250019 Prevotella phage Lak-A2, complete genome 75384-75415 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 NC_047926 Lactobacillus phage Semele, complete genome 38733-38764 9 0.719
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MG557979 Lactobacillus phage Lpa804, complete genome 9401-9432 9 0.719
NZ_AP019740_1 1.116|1779135|32|NZ_AP019740|CRISPRCasFinder 1779135-1779166 32 MT684596 Streptomyces phage Zeigle, complete genome 19693-19724 9 0.719
NZ_AP019740_1 1.116|1779135|32|NZ_AP019740|CRISPRCasFinder 1779135-1779166 32 MN994275 Streptomyces phage JXY1, complete genome 3501-3532 9 0.719
NZ_AP019740_1 1.35|1777754|33|NZ_AP019740|PILER-CR,CRT 1777754-1777786 33 NC_042100 Vibrio phage Aphrodite1, complete genome 226077-226109 10 0.697
NZ_AP019740_1 1.42|1778174|33|NZ_AP019740|PILER-CR,CRT 1778174-1778206 33 MN693904 Marine virus AFVG_250M977, complete genome 27955-27987 10 0.697
NZ_AP019740_1 1.48|1778534|33|NZ_AP019740|PILER-CR,CRT 1778534-1778566 33 NZ_CP033788 Bacillus sp. FDAARGOS_527 plasmid unnamed1, complete sequence 1926-1958 10 0.697
NZ_AP019740_1 1.57|1779074|33|NZ_AP019740|PILER-CR,CRT 1779074-1779106 33 MN693048 Marine virus AFVG_25M535, complete genome 25785-25817 10 0.697
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 LR597655 Escherichia phage T5_ev219 genome assembly, chromosome: 1 34671-34702 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MF431732 Bacteriophage T5-like pork29, complete genome 34725-34756 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MG969413 UNVERIFIED: Salmonella phage GE_vB_N8, complete genome 48285-48316 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MG065692 UNVERIFIED: Campylobacter phage C13, complete genome 12626-12657 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 LR597659 Escherichia phage T5_ev212 genome assembly, chromosome: 1 34433-34464 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MT653146 Salmonella phage 8sent1748, complete genome 34684-34715 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MF431731 Bacteriophage T5-like pork27, complete genome 34724-34755 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 AY543070 Bacteriophage T5, complete genome 34582-34613 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MT311645 Salmonella phage vB_Sen-E22, complete genome 12396-12427 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MK972716 Salmonella phage SE8, complete genome 3409-3440 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MF774688 Salmonella phage SP1a clone contig.00002 genomic sequence 19051-19082 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MT233524 Salmonella phage vB_Sen_I1, complete genome 95915-95946 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_047835 Escherichia phage OSYSP, complete genome 7306-7337 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 AY587007 Bacteriophage T5 strain ATCC 11303-B5, complete genome 34503-34534 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_031022 Shigella phage SHSML-45, complete genome 57850-57881 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MH370378 Salmonella phage S131, complete genome 72179-72210 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MK373799 Escherichia phage vB_EcoS_EASG3, complete genome 34536-34567 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MK373797 Escherichia phage vB_EcoS_HASG4, complete genome 34575-34606 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MH370377 Salmonella phage S130, partial genome 72179-72210 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MK373796 Escherichia phage vB_EcoS_HdH2, complete genome 33520-33551 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MF431733 Bacteriophage T5-like saus47N, complete genome 34725-34756 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_028754 Salmonella phage Shivani, complete genome 32455-32486 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_005859 Enterobacteria phage T5, complete genome 34582-34613 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 AY734508 Bacteriophage T5 hypothetical protein (T5p066) gene, partial cds; RNA3 (rna3) and tRNA-Asn (tRNAN) genes, complete sequence; hypothetical protein (T5p067) gene, complete cds; tRNA-Cys (tRNAC) gene, complete sequence; hypothetical protein (T5p068) and hypothetical protein (T5p069) genes, complete cds; tRNA-Phe (tRNAF), tRNA-Trp (tRNAW), tRNA-Glu (tRNAE), and tRNA-Tyr (tRNAY) genes, complete sequence; hypothetical protein (T5p070), hypothetical protein (T5p071), hypothetical protein (T5p072), and HNH endonuclease (T5p073) genes, complete cds; tRNA-Ile (tRNAI2) and tRNA-Ser (tRNAS3) genes, complete sequence; DNA primase-like protein (T5p074), hypothetical protein (T5p075), hypothetical protein (T5p076), hypothetical protein (T5p077), and putative membrane protease (T5p078) genes, complete cds; tRNA-Arg (tRNAR) and RNAX (rnaX) genes, complete sequence; and hypothetical protein (T5p079) gene, partial cds 902-933 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 KY775452 Salmonella phage Stp1 contig.00002 genomic sequence 19155-19186 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MF431735 Bacteriophage T5-like poul124, complete genome 34734-34765 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_048865 Salmonella phage oldekolle, complete genome 85525-85556 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN956514 Salmonella phage L6jm, complete genome 34289-34320 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MK373792 Escherichia phage vB_EcoS_VAH1, complete genome 26913-26944 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN316588 Escherichia virus VEc33, complete genome 35119-35150 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MT653143 Salmonella phage 3sent1, complete genome 32397-32428 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_048857 Phage NBSal005, complete genome 86697-86728 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MH102285 Salmonella phage vB_SenS_PHB06, partial genome 68906-68937 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 AJ604530 Enterobacteria phage BF23 tRNA gene region 7325-7356 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN445182 Salmonella phage vB_SalS_SA001, complete genome 31701-31732 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN379739 Salmonella phage 1-19, complete genome 56388-56419 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MF431734 Bacteriophage T5-like saus111K, complete genome 34725-34756 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_047881 Shigella phage SSP1, complete genome 107897-107928 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN026741 Salmonella phage Th1, complete genome 33909-33940 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_015269 Enterobacteria phage SPC35, complete genome 33271-33302 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN994502 Phage NBSal003, complete genome 85696-85727 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 KY114934 Salmonella phage SP01, complete genome 84915-84946 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_048000 Salmonella phage LVR16A, partial genome 47412-47443 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_047822 Escherichia phage phiLLS, complete genome 49855-49886 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 NC_047885 Bacteriophage T5-like chee24, complete genome 34725-34756 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN022787 Salmonella virus VSe12, complete genome 33864-33895 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MK972715 Salmonella phage SE11, complete genome 35285-35316 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 LN887948 Escherichia phage slur09 genome assembly slu09, chromosome : 1 99963-99994 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 MN218190 Salmonella phage 9-29, complete genome 1024-1055 10 0.688
NZ_AP019740_1 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder 1776135-1776166 32 LR027384 Escherichia virus vB_Eco_mar004NP2 genome assembly, chromosome: 1 29246-29277 10 0.688
NZ_AP019740_1 1.75|1776675|32|NZ_AP019740|CRISPRCasFinder 1776675-1776706 32 KY984068 Erwinia phage vB_EamM_Y3, complete genome 20280-20311 10 0.688
NZ_AP019740_1 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder 1777575-1777606 32 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 457983-458014 10 0.688
NZ_AP019740_1 1.93|1777755|32|NZ_AP019740|CRISPRCasFinder 1777755-1777786 32 NZ_CP023312 Vibrio anguillarum strain VIB12 isolate Sea bass plasmid p292, complete sequence 70160-70191 10 0.688
NZ_AP019740_1 1.98|1778055|32|NZ_AP019740|CRISPRCasFinder 1778055-1778086 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1151701-1151732 10 0.688
NZ_AP019740_1 1.108|1778655|32|NZ_AP019740|CRISPRCasFinder 1778655-1778686 32 MK448581 Streptococcus satellite phage Javan620, complete genome 1002-1033 10 0.688
NZ_AP019740_1 1.108|1778655|32|NZ_AP019740|CRISPRCasFinder 1778655-1778686 32 MK448590 Streptococcus satellite phage Javan634, complete genome 1002-1033 10 0.688
NZ_AP019740_1 1.111|1778835|32|NZ_AP019740|CRISPRCasFinder 1778835-1778866 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 32152-32183 10 0.688
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 NZ_CP042396 Leuconostoc citreum strain CBA3623 plasmid unnamed3, complete sequence 4070-4101 10 0.688
NZ_AP019740_1 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder 1779075-1779106 32 MK250029 Prevotella phage Lak-C1, complete genome 112806-112837 10 0.688
NZ_AP019740_1 1.111|1778835|32|NZ_AP019740|CRISPRCasFinder 1778835-1778866 32 NZ_CP036516 Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence 54501-54532 11 0.656

1. spacer 1.72|1776495|32|NZ_AP019740|CRISPRCasFinder matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 0, identity: 1.0 

aacttcatacccagctccgcaataatgctaaa	CRISPR spacer
aacttcatacccagctccgcaataatgctaaa	Protospacer
********************************

2. spacer 1.14|1776494|33|NZ_AP019740|PILER-CR,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 1, identity: 0.97 

aaacttcatacccagctccgcaataatgctaaa	CRISPR spacer
caacttcatacccagctccgcaataatgctaaa	Protospacer
 ********************************

3. spacer 1.110|1778775|32|NZ_AP019740|CRISPRCasFinder matches to MF417988 (Uncultured Caudovirales phage clone 2AX_4, partial genome) position: , mismatch: 1, identity: 0.969 

agcaagaaaccaaatcaacacatcaatttacc	CRISPR spacer
agcaagaaaccaaatcaacacatcaattcacc	Protospacer
****************************.***

4. spacer 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 1, identity: 0.969 

aatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
aaccgactcagtaagcgtgcaatccactttat	Protospacer
**.*****************************

5. spacer 1.52|1778774|33|NZ_AP019740|PILER-CR,CRT matches to MF417988 (Uncultured Caudovirales phage clone 2AX_4, partial genome) position: , mismatch: 2, identity: 0.939 

aagcaagaaaccaaatcaacacatcaatttacc	CRISPR spacer
cagcaagaaaccaaatcaacacatcaattcacc	Protospacer
 ****************************.***

6. spacer 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 2, identity: 0.939 

aaatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
taaccgactcagtaagcgtgcaatccactttat	Protospacer
 **.*****************************

7. spacer 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 2, identity: 0.938 

tcttcaagcctgatgtgtttagcaccgttcaa	CRISPR spacer
tcttcaagcctgatatgtttggcaccgttcaa	Protospacer
**************.*****.***********

8. spacer 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder matches to MF417906 (Uncultured Caudovirales phage clone 7F_8, partial genome) position: , mismatch: 2, identity: 0.938 

aatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
aatcgattaagtaagcgtgcaatccactttat	Protospacer
******.* ***********************

9. spacer 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder matches to MF417894 (Uncultured Caudovirales phage clone 7AX_4, partial genome) position: , mismatch: 2, identity: 0.938 

aatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
aatcgattaagtaagcgtgcaatccactttat	Protospacer
******.* ***********************

10. spacer 1.113|1778955|32|NZ_AP019740|CRISPRCasFinder matches to MF417905 (Uncultured Caudovirales phage clone 8AX_11, partial genome) position: , mismatch: 2, identity: 0.938 

aatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
aatcgattaagtaagcgtgcaatccactttat	Protospacer
******.* ***********************

11. spacer 1.10|1776254|33|NZ_AP019740|PILER-CR,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 3, identity: 0.909 

atcttcaagcctgatgtgtttagcaccgttcaa	CRISPR spacer
ttcttcaagcctgatatgtttggcaccgttcaa	Protospacer
 **************.*****.***********

12. spacer 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT matches to MF417894 (Uncultured Caudovirales phage clone 7AX_4, partial genome) position: , mismatch: 3, identity: 0.909 

aaatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
caatcgattaagtaagcgtgcaatccactttat	Protospacer
 ******.* ***********************

13. spacer 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT matches to MF417906 (Uncultured Caudovirales phage clone 7F_8, partial genome) position: , mismatch: 3, identity: 0.909 

aaatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
caatcgattaagtaagcgtgcaatccactttat	Protospacer
 ******.* ***********************

14. spacer 1.55|1778954|33|NZ_AP019740|PILER-CR,CRT matches to MF417905 (Uncultured Caudovirales phage clone 8AX_11, partial genome) position: , mismatch: 3, identity: 0.909 

aaatcgactcagtaagcgtgcaatccactttat	CRISPR spacer
caatcgattaagtaagcgtgcaatccactttat	Protospacer
 ******.* ***********************

15. spacer 1.60|1775775|32|NZ_AP019740|CRISPRCasFinder matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 5, identity: 0.844 

ttcagaatcaaaggcttaaaatacaatatttc	CRISPR spacer
ttataaatcaaagccttaaaatacactatttc	Protospacer
**  .******** *********** ******

16. spacer 1.60|1775775|32|NZ_AP019740|CRISPRCasFinder matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 5, identity: 0.844 

ttcagaatcaaaggcttaaaatacaatatttc	CRISPR spacer
ttataaatcaaagccttaaaatacactatttc	Protospacer
**  .******** *********** ******

17. spacer 1.2|1775774|33|NZ_AP019740|PILER-CR,CRT matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 6, identity: 0.818 

attcagaatcaaaggcttaaaatacaatatttc	CRISPR spacer
gttataaatcaaagccttaaaatacactatttc	Protospacer
.**  .******** *********** ******

18. spacer 1.2|1775774|33|NZ_AP019740|PILER-CR,CRT matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 6, identity: 0.818 

attcagaatcaaaggcttaaaatacaatatttc	CRISPR spacer
gttataaatcaaagccttaaaatacactatttc	Protospacer
.**  .******** *********** ******

19. spacer 1.57|1779074|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP043858 (Arcobacter cibarius strain H743 plasmid pACIB, complete sequence) position: , mismatch: 6, identity: 0.818 

-attatggaatgatgaaatattaattaatggtat	CRISPR spacer
cataattg-atgatgaaatattaattacaggtag	Protospacer
 ** ** * ******************  ****

20. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to MH319754 (Marine virus AG-345-L05 Ga0172272_11 genomic sequence) position: , mismatch: 6, identity: 0.812 

actaaaggtaaaacaaaaaaaagt-gataaagt	CRISPR spacer
actaaaggcaaaacaaaaaagagcagatcaaa-	Protospacer
********.***********.**. *** **.

21. spacer 1.114|1779015|32|NZ_AP019740|CRISPRCasFinder matches to MK249308 (Salmonella phage TS13, complete genome) position: , mismatch: 6, identity: 0.812 

gacagtacctgttcggttttttg-aaattgatt	CRISPR spacer
gacagtacctgttcgcctttttgcagaatggt-	Protospacer
*************** .****** *.* **.*

22. spacer 1.114|1779015|32|NZ_AP019740|CRISPRCasFinder matches to KY014601 (Escherichia phage Utah, complete genome) position: , mismatch: 6, identity: 0.812 

gacagtacctgttcggttttttg-aaattgatt	CRISPR spacer
gacagtacctgttcgcctttttgcagaatggt-	Protospacer
*************** .****** *.* **.*

23. spacer 1.63|1775955|32|NZ_AP019740|CRISPRCasFinder matches to NC_025249 (Lactococcus lactis subsp. cremoris MG1363 plasmid pFI430, complete sequence) position: , mismatch: 7, identity: 0.781 

aaagtgattgaagtaaattagggttttgctgt	CRISPR spacer
actctgattgaagtaaattagagttttcttat	Protospacer
*   *****************.***** .*.*

24. spacer 1.91|1777635|32|NZ_AP019740|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 7, identity: 0.781 

aacagcatagactgaattggcaatcttgtgag-	CRISPR spacer
aacagcatggactgacttggcaaacgc-tgatc	Protospacer
********.****** ******* * . ***

25. spacer 1.98|1778055|32|NZ_AP019740|CRISPRCasFinder matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 7, identity: 0.781 

ttgctg-ctgattctgttcttgagcctgttgac	CRISPR spacer
-ggcggcctgatgatgttcttgagcctgttggg	Protospacer
  ** * *****  *****************.

26. spacer 1.98|1778055|32|NZ_AP019740|CRISPRCasFinder matches to MK679546 (Phage AS32, partial genome) position: , mismatch: 7, identity: 0.781 

-ttgctgctgattctgttcttgagcctgttgac	CRISPR spacer
actgc-gctgattctgttcttcagcccgtttgg	Protospacer
 .*** *************** ****.*** .

27. spacer 1.104|1778415|32|NZ_AP019740|CRISPRCasFinder matches to MG592458 (Vibrio phage 1.083.O._10N.286.52.B9, partial genome) position: , mismatch: 7, identity: 0.781 

gtgatctta-atgatgagcgcgatgaatttgaa	CRISPR spacer
-tgactcaatatgatgatcgcaatgaatttgaa	Protospacer
 ***... * ******* ***.***********

28. spacer 1.104|1778415|32|NZ_AP019740|CRISPRCasFinder matches to MG592666 (Vibrio phage 2.096.O._10N.286.48.B5, partial genome) position: , mismatch: 7, identity: 0.781 

gtgatctta-atgatgagcgcgatgaatttgaa	CRISPR spacer
-tgactcaatatgatgaccgcaatgaatttgaa	Protospacer
 ***... * ******* ***.***********

29. spacer 1.105|1778475|32|NZ_AP019740|CRISPRCasFinder matches to CP031730 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

accttctttgcttattttattgcagagtccaa	CRISPR spacer
gatttctttgtttattttattgcagatcgcaa	Protospacer
. .*******.*************** . ***

30. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to MN694501 (Marine virus AFVG_250M1038, complete genome) position: , mismatch: 7, identity: 0.781 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
actaaaggtaaaactaaaaaaagcttaaatgg	Protospacer
************** ********.   ** *

31. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to MN694086 (Marine virus AFVG_250M1072, complete genome) position: , mismatch: 7, identity: 0.781 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
actaaaggtaaaactaaaaaaagcttaaatgg	Protospacer
************** ********.   ** *

32. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to NC_007110 (Rickettsia felis URRWXCal2 plasmid pRF, complete sequence) position: , mismatch: 7, identity: 0.781 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
aataagttaaatacaaaaaaaagagataaagt	Protospacer
* ***.   ** *********** ********

33. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to NC_019229 (Rickettsia felis plasmid pRF, complete sequence) position: , mismatch: 7, identity: 0.781 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
aataagttaaatacaaaaaaaagagataaagt	Protospacer
* ***.   ** *********** ********

34. spacer 1.114|1779015|32|NZ_AP019740|CRISPRCasFinder matches to NC_014755 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU02, complete sequence) position: , mismatch: 7, identity: 0.781 

gacagtacc--tgttcggttttttgaaattgatt	CRISPR spacer
--tggtatcggtggtcggttttttgaatttgatt	Protospacer
  ..***.*  ** ************* ******

35. spacer 1.40|1778054|33|NZ_AP019740|PILER-CR,CRT matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 8, identity: 0.758 

--gttgctgctgattctgttcttgagcctgttgac	CRISPR spacer
cggcggc--ctgatgatgttcttgagcctgttggg	Protospacer
  *. **  *****  *****************.

36. spacer 1.40|1778054|33|NZ_AP019740|PILER-CR,CRT matches to MK679546 (Phage AS32, partial genome) position: , mismatch: 8, identity: 0.758 

-gttgctgctgattctgttcttgagcctgttgac	CRISPR spacer
aactgc-gctgattctgttcttcagcccgtttgg	Protospacer
 ..*** *************** ****.*** .

37. spacer 1.49|1778594|33|NZ_AP019740|PILER-CR,CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.758 

gtctatcccaaactcttgtttgaccgcatctgc	CRISPR spacer
gcctgacccacacttttgtttgaccgcatcgcg	Protospacer
*.**. **** ***.***************

38. spacer 1.60|1775775|32|NZ_AP019740|CRISPRCasFinder matches to NC_015710 (Simkania negevensis Z plasmid pSn, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcagaatcaaaggcttaaaatacaatatttc	CRISPR spacer
cttattttcaaaagcttaaattacaatattcc	Protospacer
.*.*   *****.******* *********.*

39. spacer 1.62|1775895|32|NZ_AP019740|CRISPRCasFinder matches to NC_019762 (Microcoleus sp. PCC 7113 plasmid pMIC7113.07, complete sequence) position: , mismatch: 8, identity: 0.75 

aagatattcgagaacttttttagc----tgtagttt	CRISPR spacer
gagatattcgacaactttttgagcctcgtgaa----	Protospacer
.********** ******** ***    ** *

40. spacer 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder matches to MN855645 (Myoviridae sp. isolate 24, complete genome) position: , mismatch: 8, identity: 0.75 

tcttcaagcctgatgtgtttagcaccgttcaa	CRISPR spacer
cttggaagcttaatgtgtttagcaccgtcaaa	Protospacer
..*  ****.*.****************. **

41. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NC_017533 (Pantoea ananatis AJ13355 plasmid pEA320, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

42. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP017591 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgaatgt	Protospacer
********* ************** ...   *

43. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NC_016817 (Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

44. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP020944 (Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

45. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP014208 (Pantoea ananatis strain R100 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

46. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

47. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgaatgt	Protospacer
********* ************** ...   *

48. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to CP054909 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

49. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP022429 (Pantoea ananatis strain YJ76 plasmid p_unamed1) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

50. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP035036 (Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taaattgatcttgctcacatataatcgattgt	Protospacer
********* ************** ....  *

51. spacer 1.71|1776435|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

taaattgatattgctcacatataagtagcgct	CRISPR spacer
taatttgaaattgctcacatataatcaataat	Protospacer
*** **** *************** .*... *

52. spacer 1.74|1776615|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP049359 (Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

taacaagacgagagaattttatcacagaaaac	CRISPR spacer
atacaagacgagaaaattttatcgcatcatat	Protospacer
  ***********.*********.**  * *.

53. spacer 1.77|1776795|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP029460 (Clostridium novyi strain 150557 plasmid pCN2, complete sequence) position: , mismatch: 8, identity: 0.75 

gatacctttgaaagttgatcttttaaacaaac	CRISPR spacer
gatgtagttgaaagtggatcttttacacaata	Protospacer
***..  ******** ********* ****

54. spacer 1.94|1777815|32|NZ_AP019740|CRISPRCasFinder matches to MT774408 (CrAssphage cr130_1, complete genome) position: , mismatch: 8, identity: 0.75 

tttagggttgtatgcaatattgccgcgtgcat	CRISPR spacer
tttaggattgtgtgcaatattgcaatttatat	Protospacer
******.****.*********** .. *..**

55. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 8, identity: 0.75 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
tctgcatttaaaacaaaaaaaagaaataaaga	Protospacer
 **. *  *************** .******

56. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 8, identity: 0.75 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
tctgcatttaaaacaaaaaaaagaaataaaga	Protospacer
 **. *  *************** .******

57. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP041677 (Lactobacillus reuteri strain LL7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
aatgcatctaaaataaaaaatagtgataaagc	Protospacer
* *. *  *****.****** **********.

58. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to AP013501 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-U-MedDCM-OCT-S24-C60) position: , mismatch: 8, identity: 0.75 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
ataaacagtaaaagaaaaaaaagttataaata	Protospacer
*. ** .****** ********** *****

59. spacer 1.107|1778595|32|NZ_AP019740|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.75 

tctatcccaaactcttgtttgaccgcatctgc	CRISPR spacer
cctgacccacacttttgtttgaccgcatcgcg	Protospacer
.**. **** ***.***************

60. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP043858 (Arcobacter cibarius strain H743 plasmid pACIB, complete sequence) position: , mismatch: 8, identity: 0.75 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
ataattgatgatgaaatattaattacaggtag	Protospacer
 **   .******************  ****

61. spacer 1.116|1779135|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

-aaacagctagacggcgcgcgtggtgattcagg	CRISPR spacer
cgggccgat-gacggcgcgcgtggcgattccgg	Protospacer
 ...* * * **************.***** **

62. spacer 1.12|1776374|33|NZ_AP019740|PILER-CR,CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 9, identity: 0.727 

aagcattcgcctaaggaacccccatgagcaaag	CRISPR spacer
acaccctcgccaaaggaacccccatgaccatga	Protospacer
* .* .***** *************** ** ..

63. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NC_017533 (Pantoea ananatis AJ13355 plasmid pEA320, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

64. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP017591 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgaatgt	Protospacer
 ********* ************** ...   *

65. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NC_016817 (Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

66. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP020944 (Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

67. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP014208 (Pantoea ananatis strain R100 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

68. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

69. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgaatgt	Protospacer
 ********* ************** ...   *

70. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to CP054909 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

71. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP022429 (Pantoea ananatis strain YJ76 plasmid p_unamed1) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

72. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP035036 (Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaaattgatcttgctcacatataatcgattgt	Protospacer
 ********* ************** ....  *

73. spacer 1.13|1776434|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727 

ataaattgatattgctcacatataagtagcgct	CRISPR spacer
ttaatttgaaattgctcacatataatcaataat	Protospacer
 *** **** *************** .*... *

74. spacer 1.16|1776614|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP049359 (Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727 

ataacaagacgagagaattttatcacagaaaac	CRISPR spacer
tatacaagacgagaaaattttatcgcatcatat	Protospacer
   ***********.*********.**  * *.

75. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_048853 (Phage NBEco001, complete genome) position: , mismatch: 9, identity: 0.719 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaagggcttaggcgaaggattgcaaatc	Protospacer
.*.********** ************ ..

76. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_048855 (Phage NBEco002, complete genome) position: , mismatch: 9, identity: 0.719 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaagggcttaggcgaaggattgcaaatc	Protospacer
.*.********** ************ ..

77. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to AP019559 (Escherichia phage SP15 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaagggcttaggcgaaggattgcaaatc	Protospacer
.*.********** ************ ..

78. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to AJ604531 (Bacteriophage 5 tRNA gene region) position: , mismatch: 9, identity: 0.719 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaagggcttaggcgaaggattgcaaatc	Protospacer
.*.********** ************ ..

79. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_024139 (Escherichia phage vB_EcoS_FFH1, complete genome) position: , mismatch: 9, identity: 0.719 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaagggcttaggcgaaggattgcaaatc	Protospacer
.*.********** ************ ..

80. spacer 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder matches to MN693100 (Marine virus AFVG_25M381, complete genome) position: , mismatch: 9, identity: 0.719 

gaagcagtacgagtacaagaatttggatatga	CRISPR spacer
gcagtagtaggagtacaagaatttgctagtag	Protospacer
* **.**** ***************   .*..

81. spacer 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder matches to MN693190 (Marine virus AFVG_25M52, complete genome) position: , mismatch: 9, identity: 0.719 

gaagcagtacgagtacaagaatttggatatga	CRISPR spacer
gcagtagtaggagtacaagaatttgctagtag	Protospacer
* **.**** ***************   .*..

82. spacer 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder matches to MN693373 (Marine virus AFVG_25M314, complete genome) position: , mismatch: 9, identity: 0.719 

gaagcagtacgagtacaagaatttggatatga	CRISPR spacer
gcagtagtaggagtacaagaatttgctagtag	Protospacer
* **.**** ***************   .*..

83. spacer 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder matches to MN693273 (Marine virus AFVG_25M382, complete genome) position: , mismatch: 9, identity: 0.719 

gaagcagtacgagtacaagaatttggatatga	CRISPR spacer
gcagtagtaggagtacaagaatttgctagtag	Protospacer
* **.**** ***************   .*..

84. spacer 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder matches to MN693247 (Marine virus AFVG_25M51, complete genome) position: , mismatch: 9, identity: 0.719 

gaagcagtacgagtacaagaatttggatatga	CRISPR spacer
gcagtagtaggagtacaagaatttgctagtag	Protospacer
* **.**** ***************   .*..

85. spacer 1.67|1776195|32|NZ_AP019740|CRISPRCasFinder matches to MN693503 (Marine virus AFVG_25M343, complete genome) position: , mismatch: 9, identity: 0.719 

gaagcagtacgagtacaagaatttggatatga	CRISPR spacer
gcagtagtaggagtacaagaatttgctagtag	Protospacer
* **.**** ***************   .*..

86. spacer 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder matches to NZ_LT670852 (Candidatus Erwinia haradaeae strain ErCipseudotaxifoliae isolate 3056 plasmid pl1) position: , mismatch: 9, identity: 0.719 

tcttcaagcctgatgtgtttagcaccgttcaa	CRISPR spacer
acagaaagcctggtgtgtttagcacagtatag	Protospacer
 *   *******.************ ** .*.

87. spacer 1.68|1776255|32|NZ_AP019740|CRISPRCasFinder matches to NZ_LR217726 (Candidatus Erwinia haradaeae strain ErCipseudotaxifoliae isolate 3056 plasmid pBioThi) position: , mismatch: 9, identity: 0.719 

tcttcaagcctgatgtgtttagcaccgttcaa	CRISPR spacer
acagaaagcctggtgtgtttagcacagtatag	Protospacer
 *   *******.************ ** .*.

88. spacer 1.70|1776375|32|NZ_AP019740|CRISPRCasFinder matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 9, identity: 0.719 

agcattcgcctaaggaacccccatgagcaaag	CRISPR spacer
caccctcgccaaaggaacccccatgaccatga	Protospacer
 .* .***** *************** ** ..

89. spacer 1.77|1776795|32|NZ_AP019740|CRISPRCasFinder matches to LT546029 (Enterococcus phage VFW genome assembly, chromosome: VFW) position: , mismatch: 9, identity: 0.719 

gatacctttgaaagttgatcttttaaacaaac	CRISPR spacer
actcgttttaaaatttgatcttttaaacataa	Protospacer
. *  .***.*** *************** *

90. spacer 1.81|1777035|32|NZ_AP019740|CRISPRCasFinder matches to NC_010555 (Proteus mirabilis HI4320 plasmid pHI4320, complete sequence) position: , mismatch: 9, identity: 0.719 

agatgaagctaactgatctaaagttgcagcat	CRISPR spacer
ttttctaattaactgatataaagatgcagcat	Protospacer
   *  *..******** ***** ********

91. spacer 1.81|1777035|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP017056 (Providencia stuartii strain BE2467 plasmid pPS2, complete sequence) position: , mismatch: 9, identity: 0.719 

agatgaagctaactgatctaaagttgcagcat	CRISPR spacer
ttttctaattaactgatataaagatgcagcat	Protospacer
   *  *..******** ***** ********

92. spacer 1.82|1777095|32|NZ_AP019740|CRISPRCasFinder matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 9, identity: 0.719 

aatgtatatcctgaatttgggccgcctaaacc	CRISPR spacer
ggtctaaatcctgaatttgagccgcctgagag	Protospacer
..* ** ************.*******.*.

93. spacer 1.88|1777455|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 9, identity: 0.719 

tctcttgtaatgggtttcataatataatatag	CRISPR spacer
ctgactataataggcttcataatataatattg	Protospacer
..  .*.****.**.*************** *

94. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MK907268 (Escherichia phage vB_EcoS-26175II, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

95. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MK907271 (Escherichia phage vB_EcoS-26175V, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

96. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MK907269 (Escherichia phage vB_EcoS-26175III, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

97. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MT833283 (Escherichia coli phage vB_EcoS_Ace, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

98. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MK907267 (Escherichia phage vB_EcoS-26175I, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

99. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MK907270 (Escherichia phage vB_EcoS-26175IV, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

100. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MN994501 (Phage NBSal002, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

101. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to MH370375 (Salmonella phage S124, complete genome) position: , mismatch: 9, identity: 0.719 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
tcaaaaccaaaacaatcaggtgcaaaatctac	Protospacer
  ****.*****.************.   * *

102. spacer 1.91|1777635|32|NZ_AP019740|CRISPRCasFinder matches to MK448709 (Streptococcus phage Javan231, complete genome) position: , mismatch: 9, identity: 0.719 

aacagcatagactgaattggcaatcttgtgag	CRISPR spacer
aacagcatggactgacttggcaacatcaacac	Protospacer
********.****** *******. *..  *

103. spacer 1.91|1777635|32|NZ_AP019740|CRISPRCasFinder matches to MK448710 (Streptococcus phage Javan233, complete genome) position: , mismatch: 9, identity: 0.719 

aacagcatagactgaattggcaatcttgtgag	CRISPR spacer
aacagcatggactgacttggcaacatcaacac	Protospacer
********.****** *******. *..  *

104. spacer 1.93|1777755|32|NZ_AP019740|CRISPRCasFinder matches to NC_042100 (Vibrio phage Aphrodite1, complete genome) position: , mismatch: 9, identity: 0.719 

tgagtcttcgtatagaggttttgattcaacaa	CRISPR spacer
aggaagctcgtgtagaggttttaattcaacac	Protospacer
 *..  .****.**********.********

105. spacer 1.100|1778175|32|NZ_AP019740|CRISPRCasFinder matches to MN693904 (Marine virus AFVG_250M977, complete genome) position: , mismatch: 9, identity: 0.719 

atttacaagggcgtaggtattgctacttgtaa	CRISPR spacer
caccgcaagggcataggtattgccacttgcca	Protospacer
  ...*******.**********.*****. *

106. spacer 1.106|1778535|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP033788 (Bacillus sp. FDAARGOS_527 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

actaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
atggaagttaaaacagaaaaaagtgatacgtg	Protospacer
*. .*** *******.************ .

107. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MN693048 (Marine virus AFVG_25M535, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tctaatggtgatgaagtattaattagtggtat	Protospacer
*.  . ..*******.*********.******

108. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tacttatatgatgaaatattattaaatggtcc	Protospacer
*  * . ************** * ****** .

109. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to NC_048084 (Lactobacillus phage Iacchus, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tttgatggcgatgaaatatcaattaaaggtat	Protospacer
**  . ...**********.****** *****

110. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MH809531 (Lactobacillus phage Bromius, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tttgatggcgatgaaatatcaattaaaggtat	Protospacer
**  . ...**********.****** *****

111. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
ccatcatttgatgaaatatcatttaatggtaa	Protospacer
..** .  ***********.* *********

112. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
ccatcatttgatgaaatatcatttaatggtaa	Protospacer
..** .  ***********.* *********

113. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to NC_047926 (Lactobacillus phage Semele, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tttgatggcgatgaaatatcaattaaaggtat	Protospacer
**  . ...**********.****** *****

114. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MG557979 (Lactobacillus phage Lpa804, complete genome) position: , mismatch: 9, identity: 0.719 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tttgatggcgatgaaatatcaattaaaggtat	Protospacer
**  . ...**********.****** *****

115. spacer 1.116|1779135|32|NZ_AP019740|CRISPRCasFinder matches to MT684596 (Streptomyces phage Zeigle, complete genome) position: , mismatch: 9, identity: 0.719 

aaacagctagacggcgcgcgtggtgattcagg	CRISPR spacer
caccagctacacggtgcgcgtggtgagcgcga	Protospacer
 * ****** ****.*********** .  *.

116. spacer 1.116|1779135|32|NZ_AP019740|CRISPRCasFinder matches to MN994275 (Streptomyces phage JXY1, complete genome) position: , mismatch: 9, identity: 0.719 

aaacagctagacggcgcgcgtggtgattcagg	CRISPR spacer
caccagctacacggtgcgcgtggtgagcgcga	Protospacer
 * ****** ****.*********** .  *.

117. spacer 1.35|1777754|33|NZ_AP019740|PILER-CR,CRT matches to NC_042100 (Vibrio phage Aphrodite1, complete genome) position: , mismatch: 10, identity: 0.697 

gtgagtcttcgtatagaggttttgattcaacaa	CRISPR spacer
caggaagctcgtgtagaggttttaattcaacac	Protospacer
  *..  .****.**********.********

118. spacer 1.42|1778174|33|NZ_AP019740|PILER-CR,CRT matches to MN693904 (Marine virus AFVG_250M977, complete genome) position: , mismatch: 10, identity: 0.697 

gatttacaagggcgtaggtattgctacttgtaa	CRISPR spacer
tcaccgcaagggcataggtattgccacttgcca	Protospacer
   ...*******.**********.*****. *

119. spacer 1.48|1778534|33|NZ_AP019740|PILER-CR,CRT matches to NZ_CP033788 (Bacillus sp. FDAARGOS_527 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

gactaaaggtaaaacaaaaaaaagtgataaagt	CRISPR spacer
tatggaagttaaaacagaaaaaagtgatacgtg	Protospacer
 *. .*** *******.************ .

120. spacer 1.57|1779074|33|NZ_AP019740|PILER-CR,CRT matches to MN693048 (Marine virus AFVG_25M535, complete genome) position: , mismatch: 10, identity: 0.697 

attatggaatgatgaaatattaattaatggtat	CRISPR spacer
ttctaatggtgatgaagtattaattagtggtat	Protospacer
 *.  . ..*******.*********.******

121. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to LR597655 (Escherichia phage T5_ev219 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

122. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MF431732 (Bacteriophage T5-like pork29, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

123. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MG969413 (UNVERIFIED: Salmonella phage GE_vB_N8, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

124. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MG065692 (UNVERIFIED: Campylobacter phage C13, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

125. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to LR597659 (Escherichia phage T5_ev212 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

126. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MT653146 (Salmonella phage 8sent1748, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

127. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MF431731 (Bacteriophage T5-like pork27, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

128. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to AY543070 (Bacteriophage T5, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

129. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MT311645 (Salmonella phage vB_Sen-E22, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

130. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MK972716 (Salmonella phage SE8, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

131. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MF774688 (Salmonella phage SP1a clone contig.00002 genomic sequence) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

132. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MT233524 (Salmonella phage vB_Sen_I1, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

133. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_047835 (Escherichia phage OSYSP, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

134. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to AY587007 (Bacteriophage T5 strain ATCC 11303-B5, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

135. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_031022 (Shigella phage SHSML-45, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

136. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MH370378 (Salmonella phage S131, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

137. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MK373799 (Escherichia phage vB_EcoS_EASG3, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

138. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MK373797 (Escherichia phage vB_EcoS_HASG4, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

139. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MH370377 (Salmonella phage S130, partial genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

140. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MK373796 (Escherichia phage vB_EcoS_HdH2, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

141. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MF431733 (Bacteriophage T5-like saus47N, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

142. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_028754 (Salmonella phage Shivani, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

143. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_005859 (Enterobacteria phage T5, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

144. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to AY734508 (Bacteriophage T5 hypothetical protein (T5p066) gene, partial cds; RNA3 (rna3) and tRNA-Asn (tRNAN) genes, complete sequence; hypothetical protein (T5p067) gene, complete cds; tRNA-Cys (tRNAC) gene, complete sequence; hypothetical protein (T5p068) and hypothetical protein (T5p069) genes, complete cds; tRNA-Phe (tRNAF), tRNA-Trp (tRNAW), tRNA-Glu (tRNAE), and tRNA-Tyr (tRNAY) genes, complete sequence; hypothetical protein (T5p070), hypothetical protein (T5p071), hypothetical protein (T5p072), and HNH endonuclease (T5p073) genes, complete cds; tRNA-Ile (tRNAI2) and tRNA-Ser (tRNAS3) genes, complete sequence; DNA primase-like protein (T5p074), hypothetical protein (T5p075), hypothetical protein (T5p076), hypothetical protein (T5p077), and putative membrane protease (T5p078) genes, complete cds; tRNA-Arg (tRNAR) and RNAX (rnaX) genes, complete sequence; and hypothetical protein (T5p079) gene, partial cds) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

145. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to KY775452 (Salmonella phage Stp1 contig.00002 genomic sequence) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

146. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MF431735 (Bacteriophage T5-like poul124, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

147. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_048865 (Salmonella phage oldekolle, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

148. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN956514 (Salmonella phage L6jm, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

149. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MK373792 (Escherichia phage vB_EcoS_VAH1, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

150. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN316588 (Escherichia virus VEc33, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

151. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MT653143 (Salmonella phage 3sent1, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

152. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_048857 (Phage NBSal005, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

153. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MH102285 (Salmonella phage vB_SenS_PHB06, partial genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

154. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to AJ604530 (Enterobacteria phage BF23 tRNA gene region) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

155. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN445182 (Salmonella phage vB_SalS_SA001, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

156. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN379739 (Salmonella phage 1-19, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

157. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MF431734 (Bacteriophage T5-like saus111K, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

158. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_047881 (Shigella phage SSP1, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

159. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN026741 (Salmonella phage Th1, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

160. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_015269 (Enterobacteria phage SPC35, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

161. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN994502 (Phage NBSal003, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

162. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to KY114934 (Salmonella phage SP01, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

163. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_048000 (Salmonella phage LVR16A, partial genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

164. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_047822 (Escherichia phage phiLLS, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

165. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to NC_047885 (Bacteriophage T5-like chee24, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

166. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN022787 (Salmonella virus VSe12, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

167. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MK972715 (Salmonella phage SE11, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

168. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to LN887948 (Escherichia phage slur09 genome assembly slu09, chromosome : 1) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

169. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to MN218190 (Salmonella phage 9-29, complete genome) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

170. spacer 1.66|1776135|32|NZ_AP019740|CRISPRCasFinder matches to LR027384 (Escherichia virus vB_Eco_mar004NP2 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

agttgaagggcttcggcgaaggattggggtaa	CRISPR spacer
ggctgaatggcttaggcgaaggattgcaaatc	Protospacer
.*.**** ***** ************ ..

171. spacer 1.75|1776675|32|NZ_AP019740|CRISPRCasFinder matches to KY984068 (Erwinia phage vB_EamM_Y3, complete genome) position: , mismatch: 10, identity: 0.688 

ttgctaaagcgatacagatcacgaacagaatg	CRISPR spacer
ccaagatagcgatacagatcacggccagaaat	Protospacer
...  * ****************. *****

172. spacer 1.90|1777575|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaaaatcaaaataatcaggtgcaagcggttc	CRISPR spacer
acaaaatcaaaataatcgcgtgcaactttaat	Protospacer
* ***************. ****** .    .

173. spacer 1.93|1777755|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP023312 (Vibrio anguillarum strain VIB12 isolate Sea bass plasmid p292, complete sequence) position: , mismatch: 10, identity: 0.688 

tgagtcttcgtatagaggttttgattcaacaa	CRISPR spacer
ttggtcttcgtttggaggttttgattttggcg	Protospacer
* .******** *.************. .  .

174. spacer 1.98|1778055|32|NZ_AP019740|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgctgctgattctgttcttgagcctgttgac	CRISPR spacer
acgatgctggttctgttcttcagcctgaaact	Protospacer
 .* *****.********** ******  . .

175. spacer 1.108|1778655|32|NZ_AP019740|CRISPRCasFinder matches to MK448581 (Streptococcus satellite phage Javan620, complete genome) position: , mismatch: 10, identity: 0.688 

attcgtcaagctcgtagaaattgactttaacc	CRISPR spacer
taatattaagctcgcagaaagtgactttaaaa	Protospacer
   ..*.*******.***** *********

176. spacer 1.108|1778655|32|NZ_AP019740|CRISPRCasFinder matches to MK448590 (Streptococcus satellite phage Javan634, complete genome) position: , mismatch: 10, identity: 0.688 

attcgtcaagctcgtagaaattgactttaacc	CRISPR spacer
taatattaagctcgcagaaagtgactttaaaa	Protospacer
   ..*.*******.***** *********

177. spacer 1.111|1778835|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688 

atagtcattcttgaagacaagccgctcaaagg	CRISPR spacer
cgtttcattcttgaatacaagccggtcgacaa	Protospacer
    *********** ******** **.* ..

178. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP042396 (Leuconostoc citreum strain CBA3623 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
tctgtgaatgatgaaagattaatcaatgcgtc	Protospacer
*.   *********** ******.****   .

179. spacer 1.115|1779075|32|NZ_AP019740|CRISPRCasFinder matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 10, identity: 0.688 

ttatggaatgatgaaatattaattaatggtat	CRISPR spacer
ccgtcatttgatgaaatatcatttaatggtaa	Protospacer
...* .  ***********.* *********

180. spacer 1.111|1778835|32|NZ_AP019740|CRISPRCasFinder matches to NZ_CP036516 (Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

atagtcattcttgaagacaagccgctcaaagg	CRISPR spacer
cgcatcatccttgaagacgagccgctctcgat	Protospacer
   .****.*********.********  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43311 : 101987 44 Tupanvirus(21.43%) transposase,holin NA
DBSCAN-SWA_2 847015 : 915265 59 Acinetobacter_phage(12.5%) tRNA,protease,plate,integrase attL 843956:843971|attR 848602:848617
DBSCAN-SWA_3 1939454 : 1979240 53 uncultured_Caudovirales_phage(32.14%) terminase,transposase,capsid,holin NA
DBSCAN-SWA_4 2254505 : 2317049 56 uncultured_virus(18.18%) transposase,protease,holin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP019742
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP019742_1 23493-23631 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 22540-22586 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 22723-22769 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 23062-23108 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 23731-23777 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 23887-23933 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 24067-24113 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742.1 24259-24305 0 1.0

1. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 22540-22586, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

2. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 22723-22769, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

3. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 23062-23108, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

4. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 23731-23777, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

5. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 23887-23933, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

6. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 24067-24113, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

7. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to position: 24259-24305, mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 66099-66145 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 66300-66346 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 66492-66538 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 28790-28836 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 28973-29019 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 51063-51109 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 51254-51300 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 51445-51491 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 51637-51683 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 80491-80537 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 80674-80720 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 81634-81680 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 22540-22586 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 22723-22769 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 23062-23108 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 23539-23585 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 23731-23777 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 23887-23933 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 24067-24113 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 24259-24305 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 93798-93844 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 38854-38900 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 39046-39092 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 39238-39284 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 39430-39476 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 39622-39668 0 1.0
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 28216-28262 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 28406-28452 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 28598-28644 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 50872-50918 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 51826-51872 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 52015-52061 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 81826-81872 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 80866-80912 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 81058-81104 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 81250-81296 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 23254-23300 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 23446-23492 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 24491-24537 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 18-64 1 0.979
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 66682-66728 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 29162-29208 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 29351-29397 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 29540-29586 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 52181-52227 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 81442-81488 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 80300-80346 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 93418-93464 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 38472-38518 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 38663-38709 2 0.957
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 69843-69889 3 0.936
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 70034-70080 3 0.936
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 70416-70462 3 0.936
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 93609-93655 3 0.936
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 22914-22960 5 0.894
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 65907-65953 7 0.851
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP038023 Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence 28026-28072 7 0.851
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP039145 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence 50680-50726 7 0.851
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 24683-24729 7 0.851
NZ_AP019742_1 1.1|23539|47|NZ_AP019742|CRISPRCasFinder 23539-23585 47 NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 210-256 7 0.851

1. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

2. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

3. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

4. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

5. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

6. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

7. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

8. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

9. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

10. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

11. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

12. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

13. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

14. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

15. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

16. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

17. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

18. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

19. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

20. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

21. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

22. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

23. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

24. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

25. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

26. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 0, identity: 1.0 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
***********************************************

27. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

28. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

29. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

30. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

31. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaatttt-agtgctgcac	Protospacer
************************************* *********

32. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaatttt-agtgctgcac	Protospacer
************************************* *********

33. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

34. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcaattcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
*******.***************************************

35. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcaattcttcgtactagtggaacctgtaattttcagtgctgca	Protospacer
*******.***************************************

36. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcaatgctgca	Protospacer
***************************************.*******

37. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

38. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

39. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

40. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 1, identity: 0.979 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**********************************************.

41. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagagcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**** *****************************************.

42. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

43. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

44. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

45. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagagcagttcttcgtactagtggaacctgtaattttcagtgctgcg	Protospacer
**** *****************************************.

46. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcagtgttgcg	Protospacer
******************************************.***.

47. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

48. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

49. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

50. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 2, identity: 0.957 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacatgtaatttt-agtgctgcac	Protospacer
*************************** ********* *********

51. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 3, identity: 0.936 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagataagttcttcgtactagtggaacatgtaattttcagtgctgcg	Protospacer
***** ********************* ******************.

52. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 3, identity: 0.936 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagataagttcttcgtactagtggaacatgtaattttcagtgctgcg	Protospacer
***** ********************* ******************.

53. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 3, identity: 0.936 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagataagttcttcgtactagtggaacatgtaattttcagtgctgcg	Protospacer
***** ********************* ******************.

54. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 3, identity: 0.936 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaatatgtaatttt-agtgctgcac	Protospacer
**************************. ********* *********

55. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 5, identity: 0.894 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca-	CRISPR spacer
cagatcagttcttcgtactagtggaacctgtaattttcaac-ttccat	Protospacer
***************************************.. .* **

56. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 7, identity: 0.851 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacatataattttcagtttataa	Protospacer
*************************** *.*********** .   *

57. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP038023 (Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence) position: , mismatch: 7, identity: 0.851 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacatataattttcagtttataa	Protospacer
*************************** *.*********** .   *

58. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP039145 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-2, complete sequence) position: , mismatch: 7, identity: 0.851 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacatataattttcagtttataa	Protospacer
*************************** *.*********** .   *

59. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 7, identity: 0.851 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacatataattttcagtttataa	Protospacer
*************************** *.*********** .   *

60. spacer 1.1|23539|47|NZ_AP019742|CRISPRCasFinder matches to NZ_CP041296 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence) position: , mismatch: 7, identity: 0.851 

cagatcagttcttcgtactagtggaacctgtaattttcagtgctgca	CRISPR spacer
cagatcagttcttcgtactagtggaacatataattttcagtttataa	Protospacer
*************************** *.*********** .   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3092 : 69791 53 uncultured_Caudovirales_phage(23.81%) protease,transposase NA

Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AP019742.1|WP_004812234.1|62818_63046_+|hypothetical-protein 62818_63046_+ 75 aa aa NA NA NA 3092-69791 yes