Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030034 Bdellovibrio sp. NC01 chromosome, complete genome 2 crisprs Cas9_archaeal,DEDDh,cas3,csa3,DinG 1 1 3 0

Results visualization

1. NZ_CP030034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030034_1 2049188-2049342 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030034_2 3866128-3866201 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP030034_2 2.1|3866154|22|NZ_CP030034|CRISPRCasFinder 3866154-3866175 22 NZ_CP030034.1 3902450-3902471 1 0.955

1. spacer 2.1|3866154|22|NZ_CP030034|CRISPRCasFinder matches to position: 3902450-3902471, mismatch: 1, identity: 0.955

aaaagcagctaaaaaaactact	CRISPR spacer
aaaagcagctaaaaaaacttct	Protospacer
******************* **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030034_2 2.1|3866154|22|NZ_CP030034|CRISPRCasFinder 3866154-3866175 22 MN693872 Marine virus AFVG_250M911, complete genome 52680-52701 2 0.909
NZ_CP030034_2 2.1|3866154|22|NZ_CP030034|CRISPRCasFinder 3866154-3866175 22 MN693786 Marine virus AFVG_250M1027, complete genome 14472-14493 2 0.909

1. spacer 2.1|3866154|22|NZ_CP030034|CRISPRCasFinder matches to MN693872 (Marine virus AFVG_250M911, complete genome) position: , mismatch: 2, identity: 0.909

aaaagcagctaaaaaaactact	CRISPR spacer
taaaacagctaaaaaaactact	Protospacer
 ***.*****************

2. spacer 2.1|3866154|22|NZ_CP030034|CRISPRCasFinder matches to MN693786 (Marine virus AFVG_250M1027, complete genome) position: , mismatch: 2, identity: 0.909

aaaagcagctaaaaaaactact	CRISPR spacer
taaaacagctaaaaaaactact	Protospacer
 ***.*****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1175982 : 1215952 36 Tetraselmis_virus(14.29%) protease NA
DBSCAN-SWA_2 1838538 : 1846721 8 Escherichia_phage(16.67%) NA NA
DBSCAN-SWA_3 3158019 : 3165465 6 Bacillus_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage