Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035466 Klebsiella aerogenes strain LU2 chromosome, complete genome 6 crisprs csa3,cas3,DEDDh,WYL,DinG 2 1 4 0

Results visualization

1. NZ_CP035466
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035466_1 390995-391109 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035466_2 1731208-1731322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035466_3 1946895-1947021 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035466_4 2051303-2051420 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035466_5 2873625-2873698 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035466_6 3356538-3356630 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP035466_4 4.1|2051335|54|NZ_CP035466|CRISPRCasFinder 2051335-2051388 54 NZ_CP035466.1 741899-741952 0 1.0
NZ_CP035466_5 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder 2873649-2873674 26 NZ_CP035466.1 629554-629579 1 0.962
NZ_CP035466_5 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder 2873649-2873674 26 NZ_CP035466.1 2074406-2074431 1 0.962

1. spacer 4.1|2051335|54|NZ_CP035466|CRISPRCasFinder matches to position: 741899-741952, mismatch: 0, identity: 1.0

cctctccccggtggcgctgcgcttaccggggctacaaaccggagcggactggta	CRISPR spacer
cctctccccggtggcgctgcgcttaccggggctacaaaccggagcggactggta	Protospacer
******************************************************

2. spacer 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder matches to position: 629554-629579, mismatch: 1, identity: 0.962

ggctacccgcggtgccgtttttttgt	CRISPR spacer
ggctacccgcggtgtcgtttttttgt	Protospacer
**************.***********

3. spacer 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder matches to position: 2074406-2074431, mismatch: 1, identity: 0.962

ggctacccgcggtgccgtttttttgt	CRISPR spacer
ggctacccgcggcgccgtttttttgt	Protospacer
************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035466_5 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder 2873649-2873674 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324018-324043 0 1.0
NZ_CP035466_5 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder 2873649-2873674 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447528-447553 2 0.923
NZ_CP035466_5 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder 2873649-2873674 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323588-323613 5 0.808
NZ_CP035466_5 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder 2873649-2873674 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447689-447714 6 0.769

1. spacer 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

ggctacccgcggtgccgtttttttgt	CRISPR spacer
ggctacccgcggtgccgtttttttgt	Protospacer
**************************

2. spacer 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.923

ggctacccgcggtgccgtttttttgt	CRISPR spacer
cgctactcgcggtgccgtttttttgt	Protospacer
 *****.*******************

3. spacer 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.808

ggctacccgcggtgccgtttttttgt	CRISPR spacer
atctacccgcggtgccgttttttgtc	Protospacer
. *********************  .

4. spacer 5.1|2873649|26|NZ_CP035466|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.769

ggctacccgcggtgccgtttttttgt	CRISPR spacer
cactactcgcggtgccgttttttgtc	Protospacer
 .****.****************  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15850 : 56845 51 Salmonella_phage(89.19%) lysis,tail,head,capsid,tRNA,plate,terminase,integrase,portal attL 27170:27216|attR 56964:57010
DBSCAN-SWA_2 3043509 : 3069859 38 Klebsiella_phage(50.0%) tail,terminase,integrase,holin,protease attL 3040138:3040153|attR 3073276:3073291
DBSCAN-SWA_3 4543672 : 4562633 27 Klebsiella_phage(25.0%) holin,terminase,integrase attL 4543958:4543972|attR 4566027:4566041
DBSCAN-SWA_4 5036307 : 5044919 10 Escherichia_phage(33.33%) integrase attL 5031772:5031785|attR 5049253:5049266
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage