Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041363 Citrobacter amalonaticus strain 133355-SW-C4-Cam plasmid p133355_SW_C4_Cam-1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041362 Citrobacter amalonaticus strain 133355-SW-C4-Cam chromosome, complete genome 1 crisprs DEDDh,WYL,DinG,cas3,csa3 0 1 4 0

Results visualization

1. NZ_CP041362
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041362_1 2206486-2206609 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041362_1 1.1|2206529|38|NZ_CP041362|CRISPRCasFinder 2206529-2206566 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947

1. spacer 1.1|2206529|38|NZ_CP041362|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaaaatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******.*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 562369 : 570048 10 Thermobifida_phage(16.67%) NA NA
DBSCAN-SWA_2 1825284 : 1863299 50 Enterobacteria_phage(35.14%) terminase,tail,protease,holin,portal,capsid,integrase,head attL 1826245:1826304|attR 1861662:1861723
DBSCAN-SWA_3 2996910 : 3005333 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 3539415 : 3550338 11 Enterobacteria_phage(71.43%) integrase attL 3539343:3539365|attR 3550337:3550359
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage