Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030266 Mycoplasma capricolum subsp. capripneumoniae strain JF6037 chromosome, complete genome 6 crisprs NA 1 1 1 0

Results visualization

1. NZ_CP030266
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030266_1 249338-249446 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030266_2 358443-358629 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030266_3 747607-747747 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030266_4 896431-896605 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030266_5 896743-896991 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030266_6 980139-980240 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP030266_2 2.1|358495|23|NZ_CP030266|PILER-CR 358495-358517 23 NZ_CP030266.1 436802-436824 0 1.0

1. spacer 2.1|358495|23|NZ_CP030266|PILER-CR matches to position: 436802-436824, mismatch: 0, identity: 1.0

gtttaaaggtgcaacttcatttg	CRISPR spacer
gtttaaaggtgcaacttcatttg	Protospacer
***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030266_2 2.2|358570|26|NZ_CP030266|PILER-CR 358570-358595 26 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 22502-22527 4 0.846
NZ_CP030266_2 2.2|358570|26|NZ_CP030266|PILER-CR 358570-358595 26 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 22123-22148 4 0.846
NZ_CP030266_2 2.2|358570|26|NZ_CP030266|PILER-CR 358570-358595 26 NZ_CP017832 Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence 125823-125848 5 0.808
NZ_CP030266_2 2.2|358570|26|NZ_CP030266|PILER-CR 358570-358595 26 NC_022879 Enterococcus mundtii QU 25 plasmid pQY182, complete sequence 12569-12594 5 0.808
NZ_CP030266_2 2.2|358570|26|NZ_CP030266|PILER-CR 358570-358595 26 KC821622 Cellulophaga phage phi46:3, complete genome 12094-12119 6 0.769

1. spacer 2.2|358570|26|NZ_CP030266|PILER-CR matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 4, identity: 0.846

aatgtttttaggagcaaaaaacttca	CRISPR spacer
agtgtttttatgtgcaaaaaacttcc	Protospacer
*.******** * ************ 

2. spacer 2.2|358570|26|NZ_CP030266|PILER-CR matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 4, identity: 0.846

aatgtttttaggagcaaaaaacttca	CRISPR spacer
agtgtttttatgtgcaaaaaacttcc	Protospacer
*.******** * ************ 

3. spacer 2.2|358570|26|NZ_CP030266|PILER-CR matches to NZ_CP017832 (Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence) position: , mismatch: 5, identity: 0.808

aatgtttttaggagcaaaaaacttca	CRISPR spacer
cttgtttttaggaacaaaaaactaaa	Protospacer
  ***********.*********  *

4. spacer 2.2|358570|26|NZ_CP030266|PILER-CR matches to NC_022879 (Enterococcus mundtii QU 25 plasmid pQY182, complete sequence) position: , mismatch: 5, identity: 0.808

aatgtttttaggagcaaaaaacttca	CRISPR spacer
atattttttaggagcagaaaacttcg	Protospacer
*   ************.********.

5. spacer 2.2|358570|26|NZ_CP030266|PILER-CR matches to KC821622 (Cellulophaga phage phi46:3, complete genome) position: , mismatch: 6, identity: 0.769

aatgtttttaggagcaaaaaacttca	CRISPR spacer
ggagtttttaggagcagaaaacttat	Protospacer
.. *************.*******  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 127990 : 141997 13 Lactococcus_phage(25.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage