Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041962 Xanthomonas citri pv. glycines strain 1018 plasmid unnamed1 0 crisprs NA 0 0 0 0
NZ_CP041961 Xanthomonas citri pv. glycines strain 1018 chromosome, complete genome 4 crisprs WYL,DEDDh,csa3,cas3,DinG 0 4 3 0

Results visualization

1. NZ_CP041961
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041961_1 27351-27649 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041961_2 309810-309994 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041961_3 2352439-2352533 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041961_4 5082181-5082257 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041961_4 4.1|5082207|25|NZ_CP041961|CRISPRCasFinder 5082207-5082231 25 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 281138-281162 5 0.8
NZ_CP041961_1 1.5|27428|31|NZ_CP041961|CRISPRCasFinder 27428-27458 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934481-934511 6 0.806
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614842-1614875 6 0.824
NZ_CP041961_1 1.5|27428|31|NZ_CP041961|CRISPRCasFinder 27428-27458 31 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150331-150361 7 0.774
NZ_CP041961_1 1.5|27428|31|NZ_CP041961|CRISPRCasFinder 27428-27458 31 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81610-81640 7 0.774
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 MH271303 Microbacterium phage MementoMori, complete genome 20739-20772 8 0.765
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 MN813682 Microbacterium phage Matzah, complete genome 21015-21048 8 0.765
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 MK937591 Microbacterium phage Cinna, complete genome 21039-21072 8 0.765
NZ_CP041961_1 1.8|27596|31|NZ_CP041961|CRISPRCasFinder 27596-27626 31 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 380719-380749 8 0.742
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 72444-72477 11 0.676
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22147-22180 12 0.647
NZ_CP041961_1 1.7|27539|34|NZ_CP041961|CRISPRCasFinder 27539-27572 34 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116465-116498 12 0.647

1. spacer 4.1|5082207|25|NZ_CP041961|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 5, identity: 0.8

agaagccgatgtggcgtcggacgac	CRISPR spacer
gttcgccgatgcggcgtcggacgac	Protospacer
.   *******.*************

2. spacer 1.5|27428|31|NZ_CP041961|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.806

cgcatcggcgacaacgcgcgtaccg-gtggcg	CRISPR spacer
cgcagcggcgacaacgcgcgcaccatcttgc-	Protospacer
**** ***************.***.  * ** 

3. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ctcgccgagcgcggcagccagatcagtggcggcg-	CRISPR spacer
ttcgtcgagcgcggcagccagatca-tggggctgg	Protospacer
.***.******************** *** * .* 

4. spacer 1.5|27428|31|NZ_CP041961|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

5. spacer 1.5|27428|31|NZ_CP041961|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

6. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

7. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

8. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

9. spacer 1.8|27596|31|NZ_CP041961|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 8, identity: 0.742

gggctggtgggaaccgagctcggcaagggca	CRISPR spacer
ctgctggtgggaatcgagttcggcaccgcaa	Protospacer
  ***********.****.******  *  *

10. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 11, identity: 0.676

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
ctcggcgagcgcggcggccagatcctcctccatc	Protospacer
**** **********.********  .  * .. 

11. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

12. spacer 1.7|27539|34|NZ_CP041961|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1234895 : 1306803 78 Stenotrophomonas_phage(57.5%) portal,capsid,integrase,head,plate,protease,tail,holin,terminase attL 1228168:1228185|attR 1267577:1267594
DBSCAN-SWA_2 3596032 : 3719386 115 Stenotrophomonas_phage(45.65%) portal,capsid,transposase,integrase,head,plate,tRNA,tail,holin,terminase attL 3637025:3637069|attR 3675061:3675105
DBSCAN-SWA_3 4231285 : 4243055 11 Enterobacteria_phage(37.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage