1. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.867
-gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ggcaccg-ccaccggcaacgtcgcctgggcc Protospacer
***.** ******** ********* ****
2. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.867
-gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ggcaccg-ccaccggcaacgtcgcctgggcc Protospacer
***.** ******** ********* ****
3. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.867
-gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ggcaccg-ccaccggcaacgtcgcctgggcc Protospacer
***.** ******** ********* ****
4. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 6, identity: 0.8
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
ttatcacttgtgcagcatgatgcgagtgtt Protospacer
**. ******** ************ * *
5. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 6, identity: 0.8
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
ttatcacttgtgcagcatgatgcgagtgtt Protospacer
**. ******** ************ * *
6. spacer 1.6|553427|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP021182 (Sphingomonas wittichii DC-6 plasmid pDC01, complete sequence) position: , mismatch: 6, identity: 0.8
cagagatcacgctcggcacggttgataacg CRISPR spacer
agcagatcacgctcggcacggttgcgaaca Protospacer
. ********************* ***.
7. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032314 (Pannonibacter phragmitetus BB plasmid p.BB_2, complete sequence) position: , mismatch: 6, identity: 0.8
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcctcgatcggcggcttcgacgtcgaattc Protospacer
.********.** *************.*
8. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 6, identity: 0.8
ttctcgatcgacgccttcgacgtcgaacta- CRISPR spacer
acctcgatcgtcgccttcgacgtc-agcgac Protospacer
.******** ************* *.* *
9. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.8
---ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gagttct---tcgacgccttcgacatcgaaccg Protospacer
**** **************.******..
10. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.8
---ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gagttct---tcgacgccttcgacatcgaaccg Protospacer
**** **************.******..
11. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 6, identity: 0.8
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
ttctcgatcgacgcctactacgtagccctc Protospacer
**************** * **** * **
12. spacer 1.15|554021|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032532 (Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence) position: , mismatch: 6, identity: 0.8
agaagagcttgccgatgcaaagggcaagat CRISPR spacer
agaagagcttggcgctgcaaaggggatcag Protospacer
*********** ** ********* * *
13. spacer 1.18|554219|29|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.793
ggatcgccgagccggtaagctgctgaagc CRISPR spacer
gcatcgccgggccggtaagccgctgccgg Protospacer
* *******.**********.**** *
14. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 6, identity: 0.793
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
ttatcacttgtgcagcatgatgcgagtgt Protospacer
**. ******** ************ *
15. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 6, identity: 0.793
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
ttatcacttgtgcagcatgatgcgagtgt Protospacer
**. ******** ************ *
16. spacer 1.6|553427|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cagagatcacgctcggcacggttgataacg CRISPR spacer
atggcatcacgctcggcacgcttgctaact Protospacer
*. *************** *** ****
17. spacer 1.6|553427|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045343 (Vibrio sp. THAF190c plasmid pTHAF190c_e, complete sequence) position: , mismatch: 7, identity: 0.767
--cagagatcacgctcggcacggttgataacg CRISPR spacer
ggcgctggt--cgctcggcaaggttgataacg Protospacer
*. *.* ********* ***********
18. spacer 1.8|553559|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015587 (Roseomonas gilardii strain U14-5 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767
tcccatggcggcgagcccagcgagtggccg CRISPR spacer
gtcaagaacggcgagcccatcgagtggccg Protospacer
.* * ..*********** **********
19. spacer 1.8|553559|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
tcccatggcggcgagcccagcgagtggccg CRISPR spacer
ctgccgggcggcgagcccggcgagcggccg Protospacer
.. * ************.*****.*****
20. spacer 1.8|553559|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
tcccatggcggcgagcccagcgagtggccg CRISPR spacer
gttcgcggcggcgaccccagccagtggccg Protospacer
..*..******** ****** ********
21. spacer 1.8|553559|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tcccatggcggcgagcccagcgagtggccg CRISPR spacer
gcctctggcggcgatcccagcgagcggctt Protospacer
**. ********* *********.***.
22. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026281 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
23. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX147633 (Citrobacter freundii strain AMA332 plasmid pT1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
24. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX709966 (Pseudomonas aeruginosa strain IP40a plasmid pIP40a, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
25. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
26. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX869741 (Enterobacter cloacae strain 20130723 plasmid R222, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
27. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY399978 (Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
28. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY986974 (Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
29. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887592 (Citrobacter freundii strain Cf52 plasmid pCf52, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
30. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887593 (Citrobacter freundii strain Cf53 plasmid pCf53, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
31. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887594 (Klebsiella pneumoniae strain Kp55 plasmid pKp55, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
32. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
33. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_022652 (Klebsiella pneumoniae strain CRE114 plasmid pIMP-PH114, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
34. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033514 (Vibrio cholerae strain E4 plasmid pVCR94, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
35. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
36. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
37. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX458222 (Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
38. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
39. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
40. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KT997783 (Escherichia coli strain Y5 plasmid pECY53, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
41. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX156772 (Escherichia coli strain K-12 plasmid IP40a, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
42. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
43. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX156773 (Escherichia coli strain K-12 plasmid R16a, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
44. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KX029331 (Klebsiella pneumoniae strain K-109-R plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
45. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
46. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
47. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009412 (Salmonella enterica strain CFSAN007426 isolate N19767 plasmid pCFSAN007426_01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
48. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
49. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
50. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
51. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
52. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
53. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
54. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KR559889 (Klebsiella pneumoniae strain Kpn8143 plasmid pKP-Gr8143, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
55. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
56. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP742988 (Salmonella enterica subsp. enterica serovar Senftenberg strain BCH02406 plasmid pNDM-SAL, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
57. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
58. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KR091911 (Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
59. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP276584 (Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
60. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP975074 (Citrobacter freundii strain MRSN11938 plasmid pMRVIM0912, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
61. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KR559890 (Enterobacter cloacae strain Ecl4873 plasmid pEcl-Gr4873, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
62. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
63. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP056256 (Escherichia coli strain YDC637 plasmid pYDC637, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
64. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
65. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to AP014611 (Serratia marcescens plasmid p11663 DNA, complete sequence, strain: 11663) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
66. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
67. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041027 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 plasmid pSA20143792.1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
68. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025141 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
69. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
70. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017987 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
71. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
72. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017387 (Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
73. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047308 (Citrobacter freundii strain L75 plasmid pCf75, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
74. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013324 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-166, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
75. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP034402 (Escherichia coli strain CRE10 plasmid pCRE10.2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
76. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
77. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
78. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
79. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025242 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
80. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC055503 (Klebsiella pneumoniae plasmid pHM881QN DNA, complete sequence, strain: Y881) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
81. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
82. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN477204 (Escherichia coli strain S15FP06257 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
83. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027679 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
84. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017058 (Citrobacter freundii strain SL151 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
85. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020513 (Escherichia coli strain 165 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
86. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029730 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
87. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
88. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KC999035 (Escherichia coli strain EC2 plasmid pEC2-NDM-3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
89. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
90. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018716 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
91. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018722 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
92. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018704 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
93. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029249 (Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
94. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_008612 (Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
95. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
96. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
97. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
98. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT904892 (Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
99. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029802 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_90k, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
100. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP008790 (Klebsiella oxytoca KONIH1 plasmid pKOX-86d, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
101. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
102. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028316 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
103. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP009868 (Pantoea sp. PSNIH2 plasmid pPSP-100, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
104. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
105. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP042646 (Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
106. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031549 (Escherichia coli strain cq9 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
107. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032385 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
108. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032388 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
109. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC556210 (Enterobacter cloacae CC23 plasmid pCC23 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
110. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC556211 (Enterobacter cloacae CC32 plasmid pCC32 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
111. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC556212 (Klebsiella pneumoniae CC37 plasmid pCC37 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
112. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC556213 (Escherichia coli S44 plasmid pS44 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
113. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
114. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022063 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
115. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
116. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
117. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_008613 (Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
118. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
119. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031570 (Enterobacter hormaechei strain 2013_1a plasmid pIncAC2-1301491, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
120. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031564 (Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
121. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
122. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
123. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
124. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
125. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
126. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
127. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
128. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
129. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
130. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
131. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
132. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047421 (Shewanella algae strain 18064-CSB-B-B plasmid p18064-65-CSB-B-B, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
133. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
134. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026552 (Citrobacter sp. SL156 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
135. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP039562 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
136. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
137. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP038330 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
138. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP038326 (Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
139. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP030077 (Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
140. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041083 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
141. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
142. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031362 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
143. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KU160531 (Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
144. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP038322 (Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
145. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028170 (Salmonella enterica strain CFSAN064034 plasmid pGMI17-002_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
146. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_016974 (Providencia stuartii plasmid pMR0211, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
147. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP008824 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
148. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041103 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
149. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN310369 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-Ct1/2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
150. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN310370 (Klebsiella pneumoniae strain 11935 plasmid p11935-Ct1/2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
151. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
152. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021835 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000516_pilon, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
153. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
154. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
155. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045459 (Salmonella enterica subsp. enterica serovar Anatum strain M-3471 plasmid pM-3471_DHA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
156. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
157. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041641 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MCR1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
158. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026207 (Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
159. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009562 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
160. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
161. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP036192 (Klebsiella pneumoniae strain BA34918 plasmid pIncAC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
162. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040024 (Klebsiella pneumoniae strain KPC160132 plasmid pIncC-L132, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
163. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045517 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 plasmid pSal-4737_DHA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
164. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045520 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_DHA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
165. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045462 (Salmonella enterica subsp. enterica serovar Anatum strain M-3851 plasmid pM-3851_DHA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
166. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045467 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
167. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045510 (Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid pM-5360_DHA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
168. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
169. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_023291 (Vibrio cholerae strain BI144 plasmid pVCR94deltaX, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
170. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007732 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKEC-dc3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
171. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
172. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006029 (Escherichia coli O145:H28 str. RM13514 plasmid pRM13514, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
173. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040039 (Klebsiella pneumoniae strain KPC160125 plasmid pIncC-L125) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
174. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
175. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
176. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031610 (Escherichia coli strain N3 plasmid pIncAC2-1502318, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
177. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031584 (Klebsiella pneumoniae strain N4b plasmid pIncAC2-1502320, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
178. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
179. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007137 (Escherichia coli O145:H28 str. RM12581 plasmid pRM12581, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
180. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029123 (Escherichia coli strain AR434 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
181. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047350 (Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
182. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
183. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021719 (Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
184. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024824 (Escherichia coli strain CREC-591 plasmid pCREC-591_3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
185. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031573 (Enterobacter hormaechei strain N1 plasmid pIncAC2-1502262, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
186. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
187. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
188. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_021667 (Klebsiella pneumoniae plasmid IncA/C-LS6, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
189. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP003998 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13e, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
190. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047345 (Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
191. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047353 (Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
192. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
193. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026405 (Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
194. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
195. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
196. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
197. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
198. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
199. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
200. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
201. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
202. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031576 (Enterobacter hormaechei strain A1 plasmid pIncAC2-1502264, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
203. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
204. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
205. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP050162 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
206. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035908 (Klebsiella pneumoniae strain BA4656 plasmid pIncAC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
207. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041172 (Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
208. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
209. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
210. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018457 (Shewanella algae strain CCU101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
211. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MK638972 (Escherichia coli J53 plasmid pMG252, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
212. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016013 (Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 plasmid pCFSAN003890, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
213. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
214. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032496 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
215. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
216. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP011540 (Klebsiella aerogenes strain G7 plasmid pGPN1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
217. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
218. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019065 (Escherichia coli plasmid pPG010208, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
219. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
220. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
221. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
222. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
223. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
224. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KY014465 (Vibrio parahaemolyticus plasmid pVPS114, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
225. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KY014466 (Vibrio vulnificus plasmid pVVS1-per1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
226. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
227. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP019001 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
228. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023724 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
229. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_016976 (Klebsiella pneumoniae plasmid pR55, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
230. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044075 (Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
231. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026225 (Aeromonas sp. ASNIH3 plasmid pKPC-8e09, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
232. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP034397 (Escherichia coli strain CRE1 plasmid pCRE1.2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
233. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
234. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC536681 (Klebsiella pneumoniae MyNCGM076 plasmid pMyNCGM076, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
235. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC536682 (Klebsiella pneumoniae MyNCGM079 plasmid pMyNCGM079, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
236. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KM506769 (Uncultured bacterium plasmid pKAZ1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
237. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045016 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
238. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021853 (Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
239. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017055 (Providencia stuartii strain BE2467 plasmid pPS1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
240. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
241. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044962 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
242. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
243. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018318 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
244. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN823987 (Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
245. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KR827391 (Uncultured bacterium plasmid pKAZ2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
246. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KR827392 (Uncultured bacterium plasmid pKAZ3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
247. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KR827393 (Uncultured bacterium plasmid pKAZ4, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
248. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KR827394 (Uncultured bacterium plasmid pKAZ5, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
249. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007558 (Citrobacter freundii CFNIH1 plasmid pKEC-a3c, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
250. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021709 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
251. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021551 (Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
252. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025236 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
253. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
254. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP018672 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
255. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009570 (Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
256. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009564 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
257. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009563 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
258. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP011622 (Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
259. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
260. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014295 (Klebsiella pneumoniae strain KP38731 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
261. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
262. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031106 (Escherichia coli strain AMSCJX02 plasmid pAMSC1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
263. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012902 (Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
264. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
265. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018689 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
266. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019107 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_174, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
267. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019116 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
268. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019118 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
269. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
270. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020049 (Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
271. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP019053 (Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
272. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029743 (Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
273. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
274. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032192 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
275. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026233 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-0b27, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
276. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
277. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
278. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
279. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
280. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
281. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP046773 (Vibrio alginolyticus strain 2014V-1011 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
282. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014775 (Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
283. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025245 (Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 plasmid pSNE2-2012K-0663, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
284. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019375 (Providencia stuartii plasmid pTC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
285. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
286. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
287. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_022377 (Escherichia coli strain SCEC2 plasmid pSCEC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
288. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021695 (Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
289. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021952 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
290. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
291. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050732 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST101 plasmid pST101-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
292. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_023898 (Klebsiella pneumoniae plasmid pRMH760, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
293. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
294. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025144 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
295. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP025147 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
296. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to LC225353 (Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
297. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
298. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
299. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029718 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
300. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LN831185 (Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
301. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
302. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050727 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 plasmid pST-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
303. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050740 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
304. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
305. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015394 (Klebsiella pneumoniae strain CR14 plasmid pCR14_2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
306. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018698 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
307. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
308. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP045953 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 plasmid pAUSMDU00008979_01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
309. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN550958 (Proteus mirabilis strain PRT-ndm plasmid pPM154, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
310. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
311. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
312. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT882699 (Enterobacter cloacae isolate Enterobacter cloacae ENCL58 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
313. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985220 (Escherichia coli strain 83 plasmid RCS1TR83_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
314. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985225 (Escherichia coli strain 89 plasmid RCS2TR89_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
315. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985258 (Escherichia coli strain 726 plasmid RCS54TR726_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
316. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985222 (Escherichia coli strain 548 plasmid RCS24TR548_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
317. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985228 (Escherichia coli strain 552 plasmid RCS28TR552_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
318. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985218 (Escherichia coli strain 541 plasmid RCS18TR541_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
319. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985260 (Escherichia coli strain 724 plasmid RCS53TR724_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
320. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985253 (Escherichia coli strain 660 plasmid RCS48TR660_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
321. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
322. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985224 (Escherichia coli strain 513 plasmid RCS30_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
323. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985243 (Escherichia coli strain 722 plasmid RCS41_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
324. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
325. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LT985244 (Escherichia coli strain 167 plasmid RCS39_p, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
326. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018956 (Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
327. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
328. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
329. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018710 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
330. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK733575 (Escherichia coli strain J53 plasmid pMG252A, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
331. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK388209 (Escherichia coli strain Ec20-Lar plasmid pC-Ec20-KPC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
332. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK439959 (Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
333. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
334. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
335. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK770642 (Klebsiella pneumoniae strain T38 plasmid pT38_MCR3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
336. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
337. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MN148427 (Proteus vulgaris strain PV835 plasmid pPV835TEM24, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
338. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_022522 (Salmonella enterica subsp. enterica serovar Kentucky strain 1643/10 plasmid p1643_10, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
339. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
340. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
341. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657252 (Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
342. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032380 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
343. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032448 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
344. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
345. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
346. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
347. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH917285 (Klebsiella pneumoniae strain 427113 plasmid p427113-Ct1/2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
348. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH909327 (Klebsiella pneumoniae strain 526316 plasmid p526316-KPC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
349. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
350. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
351. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH760469 (Salmonella enterica strain 2016K-0796 plasmid p2016K-0796, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
352. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK205418 (Salmonella enterica subsp. enterica serovar Dublin strain 14-1360 plasmid p14-1360-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
353. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK205416 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01070 plasmid pN13-01070-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
354. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK205417 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01141 plasmid pN13-01141, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
355. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH061195 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
356. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
357. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
358. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
359. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
360. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
361. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
362. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
363. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
364. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
365. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009410 (Salmonella enterica strain CFSAN007405 isolate 30034 plasmid pCFSAN007405_01, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
366. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MG764534 (Klebsiella aerogenes strain EA409 plasmid pEA409TEM24, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
367. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF627444 (Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
368. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
369. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF150121 (Klebsiella pneumoniae strain A64477 plasmid pKP64477c, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
370. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF150123 (Klebsiella pneumoniae strain A64216 plasmid pKP64216b, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
371. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF344573 (Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
372. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF344572 (Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
373. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
374. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MG450360 (Escherichia coli strain AMA566 plasmid pAMA566, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
375. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MG252895 (Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
376. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
377. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
378. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH475146 (Citrobacter freundii strain 164 plasmid pCf164_LMB-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
379. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH763829 (Citrobacter freundii strain JY-17 plasmid pCFJY-17, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
380. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
381. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MH844629 (Escherichia coli strain 2248 plasmid pNDM-2248, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
382. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MT219816 (Escherichia coli strain RF173-1 plasmid pRF173-1_87k_tetX, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
383. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887591 (Escherichia coli strain Ec19 plasmid pEc19, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
384. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887596 (Escherichia coli strain Ec158 plasmid pEc158, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
385. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887590 (Escherichia coli strain Ec9 plasmid pEc9, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
386. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KY887595 (Escherichia coli strain Ec78 plasmid pEc78, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
387. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF582638 (Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
388. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
389. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
390. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
391. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF497432 (Vibrio alginolyticus strain Vb0506 plasmid pVb0506, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
392. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040068 (Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
393. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028814 (Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
394. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020913 (Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
395. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029737 (Providencia rettgeri strain AR_0082 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
396. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP048384 (Citrobacter freundii strain 62 plasmid p6_B, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
397. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032168 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
398. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP053192 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37b, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
399. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MT151380 (Vibrio cholerae strain YA00120881 plasmid pYA00120881, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
400. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP054305 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393B, complete sequence) position: , mismatch: 7, identity: 0.767
aaagaactcgacggatgctggcgactggtg CRISPR spacer
gcagaactcgacggaagctggagaccgttc Protospacer
. ************* ***** ***.* *
401. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.767
-ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctccg-cgacgccttcgacgtcgagctg Protospacer
. *** . ******************.**.
402. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 7, identity: 0.767
--ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgcttcg--cgacgccttcgacgtcgagctg Protospacer
..*** ******************.**.
403. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 7, identity: 0.767
-ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctccg-cgacgccttcgacgtcgagctg Protospacer
. *** . ******************.**.
404. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
tgctcgaccaccggccacggcgcgtcgagc Protospacer
**************** *** ***. *
405. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_009471 (Acidiphilium cryptum JF-5 plasmid pACRY05, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
atacggaccaccggccacggcgcatcggcg Protospacer
..*. ************** *** *****
406. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
gcgcgctccgccggcctcgtcgcctcggcc Protospacer
**.. **.****** *************
407. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgaccaccggccacgtc---gcctcggcc CRISPR spacer
gcatcgaccaccgtccacgtccgaacccca--- Protospacer
************* ******* .**.*.
408. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
acatcgaccaccggccagttcgcccagggt Protospacer
.**************** *****. ** .
409. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to KY971609 (Pseudomonas phage PspYZU01, complete genome) position: , mismatch: 7, identity: 0.767
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
tcaatctcctccggccacgtctcctcggcc Protospacer
** . ** *********** ********
410. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 7, identity: 0.767
-gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
gacgtc-cccaccggccacgtcgcatcgggt Protospacer
.*.** **************** **** .
411. spacer 1.15|554021|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.767
agaagagcttgccgatgcaaagggcaagat CRISPR spacer
taccgagcttgccgaggcaaagggcacgaa Protospacer
. *********** ********** **
412. spacer 1.15|554021|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.767
agaagagcttgccgatgcaaagggcaagat CRISPR spacer
taccgagcttgccgaggcaaagggcacgaa Protospacer
. *********** ********** **
413. spacer 1.15|554021|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 7, identity: 0.767
agaagagcttgccgatgcaaagggcaagat CRISPR spacer
cgtcggccttgccgatgccaaggacaagat Protospacer
* *. *********** ****.******
414. spacer 1.16|554087|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007453 (Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence) position: , mismatch: 7, identity: 0.767
cgcctgccagtatgaaaacccaactcagga CRISPR spacer
ggaagaccagtatgaaaacgcaactaagga Protospacer
* .************* ***** ****
415. spacer 1.7|553493|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
atcccagcgcatcgccccgagggcgtggta CRISPR spacer
cgtgccgcgcatcgccccgctggcgtggtc Protospacer
. * ************* ********
416. spacer 1.8|553559|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 8, identity: 0.733
tcccatggcggcgagcccagcgagtggccg CRISPR spacer
gcgttcaacggcgagcccagcgtgtggccg Protospacer
* . ...************** *******
417. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 8, identity: 0.733
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
ttctcgatcgaggcctccgacgtctcgacc Protospacer
*********** ****.******* . .
418. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gtgccgatcgacgccttcgacgtggagaag Protospacer
* .******************* **. .
419. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_015685 (Oligotropha carboxidovorans OM5 plasmid pOC167, complete sequence) position: , mismatch: 8, identity: 0.733
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcatcgatcggcggcttcgacgtcgaatac Protospacer
. *******.** *************.
420. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
cgctcgctcgacgccttcgacttcgccatc Protospacer
. **** ************** *** *
421. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_048098 (Arthrobacter phage Andrew, complete genome) position: , mismatch: 8, identity: 0.733
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
tgcttgatcgacgccttcgacgccggtacc Protospacer
* **.*****************.**. .
422. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
ggcgcgctcgacgccttcgaggtcgaaggc Protospacer
* ** ************* ******
423. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ttgctcaccaccggccacatcgcctcggcg Protospacer
.... ************.**********
424. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
acgacgacctccggccacgtcgccttgatg Protospacer
.*. ***** ***************.*..
425. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MN703409 (Arthrobacter phage LittleTokyo, complete genome) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
tcatcgaccaccggccactccgcctgaaag Protospacer
***************** .***** ..
426. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ctcaagacctccggcctcgtcgcctcgggc Protospacer
. **** ****** *********** *
427. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ctcaagacctccggcctcgtcgcctcgggc Protospacer
. **** ****** *********** *
428. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
ctcaagacctccggcctcgtcgcctcgggc Protospacer
. **** ****** *********** *
429. spacer 1.13|553889|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcgaccaccggccacgtcgcctcggcc CRISPR spacer
cagtacaccaccggcctcttcgcctcggcg Protospacer
.* ********** * **********
430. spacer 1.16|554087|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 8, identity: 0.733
cgcctgccagtatgaaaacccaactcagga CRISPR spacer
ttcctatcagtatgaaaacccaacttatag Protospacer
. ***..******************.* ..
431. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
432. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MF564201 (Escherichia phage vB_EcoS-95, complete genome) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
433. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to NC_049817 (Escherichia phage tonnikala, complete genome) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
434. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850586 (Escherichia phage orkinos, complete genome) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
435. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
436. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
437. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
438. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to NC_049819 (Escherichia phage atuna, complete genome) position: , mismatch: 8, identity: 0.724
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggcaacttgtaccgcatgatgcgaggct Protospacer
. .*.******.**************.
439. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
440. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
441. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
442. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
443. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
444. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
445. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
446. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
447. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
448. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
449. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcagcagccttcttagcagcagc Protospacer
************ ************..*.*. .
450. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 8, identity: 0.765
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcggcagt Protospacer
*********.** ***********...***. *
451. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
452. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MF564201 (Escherichia phage vB_EcoS-95, complete genome) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
453. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to NC_049817 (Escherichia phage tonnikala, complete genome) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
454. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
455. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850586 (Escherichia phage orkinos, complete genome) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
456. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
457. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to NC_049819 (Escherichia phage atuna, complete genome) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
458. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 9, identity: 0.7
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggcaacttgtaccgcatgatgcgaggcta Protospacer
. .*.******.**************.
459. spacer 1.9|553625|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_015685 (Oligotropha carboxidovorans OM5 plasmid pOC167, complete sequence) position: , mismatch: 9, identity: 0.7
aaagaactcgacggatgctggcgactggtg CRISPR spacer
ctcgaactcgccgcatgctggcgactaacc Protospacer
******* ** ************...
460. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to MT889375 (Arthrobacter phage Adumb2043, complete genome) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gaagcgatcgccgccttcgacgtcgacgcc Protospacer
****** *************** .
461. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gtggaaatcgacgccttcgacgccgaaaag Protospacer
* .****************.**** .
462. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtcgagctg Protospacer
. ..* ******************.**.
463. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtcgagctg Protospacer
. ..* ******************.**.
464. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gaggcgctcgacgccttcgaggtcgaaggc Protospacer
** ************* ******
465. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gaggcgctcgacgccttcgaggtcgaaggc Protospacer
** ************* ******
466. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtagaactg Protospacer
. ..* *************** *****.
467. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtcgagctg Protospacer
. ..* ******************.**.
468. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to HQ332141 (Halorubrum phage CGphi46 genomic sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
agcgggagcgacgccttcgacgtcgacgag Protospacer
* ** ****************** .
469. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtggaactg Protospacer
. ..* *************** *****.
470. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcctcgatctacgccttcgtcgtcggtgcc Protospacer
.******* ********* *****. .
471. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtcgagctg Protospacer
. ..* ******************.**.
472. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtggaactg Protospacer
. ..* *************** *****.
473. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtcgagctg Protospacer
. ..* ******************.**.
474. spacer 1.10|553691|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ttctcgatcgacgccttcgacgtcgaacta CRISPR spacer
gcgctgcgcgacgccttcgacgtggaactg Protospacer
. ..* *************** *****.
475. spacer 1.15|554021|30|NZ_CP036289|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.7
agaagagcttgccgatgcaaagggcaagat CRISPR spacer
cgaagagcttgccgatgcaagggaacgccg Protospacer
*******************.**. .
476. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850604 (Escherichia phage tunzivis, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
477. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
478. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN781674 (Escherichia phage vB_EcoS_XY3, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
479. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MK962751 (Shigella phage JK16, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
480. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850634 (Escherichia phage tinuso, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
481. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850606 (Escherichia phage tuinn, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
482. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to LT841304 (Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
483. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to LR596614 (Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
484. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to MN850638 (Escherichia phage tunus, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
485. spacer 1.21|553163|29|NZ_CP036289|PILER-CR matches to NC_049815 (Escherichia phage tonn, complete genome) position: , mismatch: 9, identity: 0.69
gtacgacttgtgccgcatgatgcgagaga CRISPR spacer
aggaaacttgtaccgcatgatgcgaggct Protospacer
. . .******.**************.
486. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
487. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
488. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
489. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
490. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
491. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
492. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
493. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
494. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012271 (Pediococcus damnosus strain TMW 2.1532 plasmid pL21532-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
495. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
496. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
497. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
498. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
499. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
500. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
501. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
502. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
503. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012277 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
504. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
505. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
506. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
507. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
508. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
509. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
510. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
511. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
512. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
513. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_CP012289 (Pediococcus damnosus strain TMW 2.1535 plasmid pL21535-1, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttagcggcagccttcttagcagcagc Protospacer
************ .***********..*.*. .
514. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to KP792623 (Rhodoferax phage P26218, complete genome) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
aagccttcttgggtgcagccttcttgcccttggc Protospacer
*********.** ************ * * .
515. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcggcagc Protospacer
*********.** ***********...***. .
516. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcggcagc Protospacer
*********.** ***********...***. .
517. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcggcagc Protospacer
*********.** ***********...***. .
518. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 9, identity: 0.735
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcggcagc Protospacer
*********.** ***********...***. .
519. spacer 2.4|1622406|37|NZ_CP036289|CRT matches to MF497422 (Vibrio phage vB_VspS_VS-ABTNL-3, complete genome) position: , mismatch: 9, identity: 0.757
cagccttcttaggtgctgctttcttcttcggtgccgc CRISPR spacer
gcgctttcttagctgctgctttcttcttagccgcagg Protospacer
**.******* *************** * .** *
520. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850604 (Escherichia phage tunzivis, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
521. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
522. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to LT841304 (Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
523. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to LR596614 (Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
524. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN781674 (Escherichia phage vB_EcoS_XY3, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
525. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MK962751 (Shigella phage JK16, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
526. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850634 (Escherichia phage tinuso, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
527. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850638 (Escherichia phage tunus, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
528. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to NC_049815 (Escherichia phage tonn, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
529. spacer 1.2|553163|30|NZ_CP036289|CRT,CRISPRCasFinder matches to MN850606 (Escherichia phage tuinn, complete genome) position: , mismatch: 10, identity: 0.667
gtacgacttgtgccgcatgatgcgagagat CRISPR spacer
aggaaacttgtaccgcatgatgcgaggcta Protospacer
. . .******.**************.
530. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to MK279840 (Mycobacterium phage JacoRen57, complete genome) position: , mismatch: 10, identity: 0.706
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttcttgggtgcagccttcttcggctcgtc Protospacer
**********.** *********** . . *.
531. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 10, identity: 0.706
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcagcagc Protospacer
*********.** ***********...*.*. .
532. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 10, identity: 0.706
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcagcagc Protospacer
*********.** ***********...*.*. .
533. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 10, identity: 0.706
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcagcagc Protospacer
*********.** ***********...*.*. .
534. spacer 2.3|1622352|34|NZ_CP036289|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 10, identity: 0.706
cagccttcttaggagcagccttcttgacggtctt CRISPR spacer
cagccttctcagcagcagccttctcagcagcagc Protospacer
*********.** ***********...*.*. .
535. spacer 2.4|1622406|37|NZ_CP036289|CRT matches to MH327487 (Marine virus AG-341-P01 Ga0172215_14 genomic sequence) position: , mismatch: 10, identity: 0.73
cagccttcttaggtgctgctttcttcttcggtgccgc CRISPR spacer
atctcttcttaggtgctgctttagtcttcgtcgtcgt Protospacer
.****************** ****** .*.**.
536. spacer 2.4|1622406|37|NZ_CP036289|CRT matches to MH319758 (Marine virus AG-345-O18 Ga0172273_12 genomic sequence) position: , mismatch: 10, identity: 0.73
cagccttcttaggtgctgctttcttcttcggtgccgc CRISPR spacer
atctcttcttaggtgctgctttagtcttcgtcgtcgt Protospacer
.****************** ****** .*.**.