1. spacer 5.15|5421985|31|NZ_CP036317|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
caggtctcttcagaatgttgccgtcgatact CRISPR spacer
cggaggtctccagcatgttgccgtcgatact Protospacer
*.*. ***.*** *****************
2. spacer 5.51|5421985|33|NZ_CP036317|PILER-CR,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
caggtctcttcagaatgttgccgtcgatactcg CRISPR spacer
cggaggtctccagcatgttgccgtcgatactgg Protospacer
*.*. ***.*** ***************** *
3. spacer 5.1|5421063|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 8, identity: 0.75
gtcctgt--atgctgccggggttattgctgctct CRISPR spacer
--ccggccgatgctgccggcgttattgttgctgc Protospacer
** *. ********** *******.**** .
4. spacer 5.12|5421786|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.75
ccttccacgttccggatgatgcgttcgcgtgt CRISPR spacer
actgccacgtgccggatgatgcgtgtccattt Protospacer
** ****** ************* . *.* *
5. spacer 5.18|5422184|34|NZ_CP036317|CRISPRCasFinder matches to MN693421 (Marine virus AFVG_25M197, complete genome) position: , mismatch: 8, identity: 0.765
cagtccatgaaaccatcattggatacgttgtcct CRISPR spacer
ttatctatgaaaccatcattagatacgttggtat Protospacer
. .**.**************.********* . *
6. spacer 5.18|5422184|34|NZ_CP036317|CRISPRCasFinder matches to MN693283 (Marine virus AFVG_25M198, complete genome) position: , mismatch: 8, identity: 0.765
cagtccatgaaaccatcattggatacgttgtcct CRISPR spacer
ttatctatgaaaccatcattagatacgttggtat Protospacer
. .**.**************.********* . *
7. spacer 5.19|5422252|33|NZ_CP036317|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758
atcagtaaatcctttgtgtaaaaatgccccgca CRISPR spacer
attagtaaatcctttgtgtataaatccttttct Protospacer
**.***************** **** *... *
8. spacer 5.27|5422795|35|NZ_CP036317|CRISPRCasFinder matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 8, identity: 0.771
ccggaaacccgctgcggcgttcccgaccaggccag CRISPR spacer
cgtgacgtccgctgcggcgctcccgacccggcctg Protospacer
* ** ..***********.******** **** *
9. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
10. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
11. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
12. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
13. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
14. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
15. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cactttccccaggaccttggttttgatcttct CRISPR spacer
gaccttccccaggagcttggttttggtagtgg Protospacer
**.********** **********.* *
16. spacer 5.55|5422252|35|NZ_CP036317|PILER-CR,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 8, identity: 0.771
atcagtaaatcctttgtgtaaaaatgccccgcaat CRISPR spacer
attagtaaatcctttgtgtataaatccttttctat Protospacer
**.***************** **** *... * **
17. spacer 2.1|1353873|31|NZ_CP036317|CRISPRCasFinder matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
ggctgaattgacagaatctgtattggaaggc CRISPR spacer
ttatgaattgacagattctctattggatcaa Protospacer
************ *** ******* .
18. spacer 6.68|6885511|36|NZ_CP036317|CRISPRCasFinder matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 9, identity: 0.75
aagttcttcaagaaattcatcatctatatcatcatc CRISPR spacer
catatcttcaaataattcatcatctatatcgttaaa Protospacer
* *******. *****************.*.*
19. spacer 5.12|5421786|32|NZ_CP036317|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688
ccttccacgttccggatgatgcgttcgcgtgt CRISPR spacer
agaagcacgttcaggatgttgcgttcgcgcag Protospacer
******* ***** **********..
20. spacer 5.25|5422660|34|NZ_CP036317|CRISPRCasFinder matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 10, identity: 0.706
tttgacacagatcaacgccgcatagtcaccacct CRISPR spacer
caggacgcagatcaacgccgcatagtctgtctat Protospacer
. ***.******************** . . *
21. spacer 5.25|5422660|34|NZ_CP036317|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 10, identity: 0.706
tttgacacagatcaacgccgcatagtcaccacct CRISPR spacer
aaggacgcagatcaacgccgcatagtctgtctat Protospacer
***.******************** . . *
22. spacer 5.25|5422660|34|NZ_CP036317|CRISPRCasFinder matches to NZ_CP043384 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid p1_045001, complete sequence) position: , mismatch: 10, identity: 0.706
tttgacacagatcaacgccgcatagtcaccacct CRISPR spacer
aaggacgcagatcaacgccgcatagtctgtctat Protospacer
***.******************** . . *
23. spacer 5.25|5422660|34|NZ_CP036317|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 10, identity: 0.706
tttgacacagatcaacgccgcatagtcaccacct CRISPR spacer
aaggacgcagatcaacgccgcatagtctgtctat Protospacer
***.******************** . . *
24. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
25. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
26. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
27. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
28. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
29. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
30. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
31. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
32. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
33. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
34. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
35. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
36. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
37. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
38. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
39. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
40. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
41. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
42. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgc Protospacer
**** ******** **********.. . .
43. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
44. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
45. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
46. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
47. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
48. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
49. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
50. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
51. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
52. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
53. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
54. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
55. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
56. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
57. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
58. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
59. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
60. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
61. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
62. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
63. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
64. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
65. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
66. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
67. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
68. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
69. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
70. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
71. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
72. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
73. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
74. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
75. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
76. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
77. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
78. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
79. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
80. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
81. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
82. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
83. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
84. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
85. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
86. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
87. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
88. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
89. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
90. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
91. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
92. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
93. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
94. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
95. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
96. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
97. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
98. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
99. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
100. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
101. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
102. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
103. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
104. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
105. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
106. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
107. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
108. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
109. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
110. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
111. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
112. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
113. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
114. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
115. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
116. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
117. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
118. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
119. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
120. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
121. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
122. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
123. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
124. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
125. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
126. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
127. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
128. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
129. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
130. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
131. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
132. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
133. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
134. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
135. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
136. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
137. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
138. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
139. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
140. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
141. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
142. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
143. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
144. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
145. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
146. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
147. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
148. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
149. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
150. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
151. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
152. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
153. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
154. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
155. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
156. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
157. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
158. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
159. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
160. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
161. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
162. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
163. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
164. spacer 5.28|5422864|32|NZ_CP036317|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cactttccccaggaccttggttttgatcttct CRISPR spacer
gacttgccccaggagcttggttttggcagcgg Protospacer
**** ******** **********.. .
165. spacer 5.54|5422184|36|NZ_CP036317|PILER-CR,CRT matches to MN693421 (Marine virus AFVG_25M197, complete genome) position: , mismatch: 10, identity: 0.722
cagtccatgaaaccatcattggatacgttgtcctat CRISPR spacer
ttatctatgaaaccatcattagatacgttggtattc Protospacer
. .**.**************.********* . * .
166. spacer 5.54|5422184|36|NZ_CP036317|PILER-CR,CRT matches to MN693283 (Marine virus AFVG_25M198, complete genome) position: , mismatch: 10, identity: 0.722
cagtccatgaaaccatcattggatacgttgtcctat CRISPR spacer
ttatctatgaaaccatcattagatacgttggtattc Protospacer
. .**.**************.********* . * .
167. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
168. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
169. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
170. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
171. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
172. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
173. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gaccttccccaggagcttggttttggtagtggca Protospacer
**.********** **********.* *
174. spacer 6.21|6884854|36|NZ_CP036317|PILER-CR,CRT matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 10, identity: 0.722
ccatatcagtaccgtctcctttaccctacgttaatt CRISPR spacer
ccatatcggtaccgactcctttacccctaacccctt Protospacer
*******.****** ***********. ... **
175. spacer 6.30|6885510|37|NZ_CP036317|PILER-CR,CRT matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 10, identity: 0.73
taagttcttcaagaaattcatcatctatatcatcatc CRISPR spacer
gcatatcttcaaataattcatcatctatatcgttaaa Protospacer
* *******. *****************.*.*
176. spacer 6.59|6884855|35|NZ_CP036317|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 10, identity: 0.714
catatcagtaccgtctcctttaccctacgttaatt CRISPR spacer
catatcggtaccgactcctttacccctaacccctt Protospacer
******.****** ***********. ... **
177. spacer 5.27|5422795|35|NZ_CP036317|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 11, identity: 0.686
ccggaaacccgctgcggcgttcccgaccaggccag CRISPR spacer
gaaggtcgccgctgtggcgttcccgaccatgcctc Protospacer
.*. ******.************** ***
178. spacer 5.27|5422795|35|NZ_CP036317|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 11, identity: 0.686
ccggaaacccgctgcggcgttcccgaccaggccag CRISPR spacer
gaaggtcgccgctgtggcgttcccgaccatgcctc Protospacer
.*. ******.************** ***
179. spacer 5.48|5421786|34|NZ_CP036317|PILER-CR,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 12, identity: 0.647
ccttccacgttccggatgatgcgttcgcgtgtcc CRISPR spacer
agaagcacgttcaggatgttgcgttcgcgcagat Protospacer
******* ***** **********.. .
180. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
181. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
182. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
183. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
184. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
185. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
186. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
187. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
188. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
189. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
190. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
191. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
192. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
193. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
194. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
195. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
196. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
197. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
198. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcgcca Protospacer
**** ******** **********.. . .
199. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
200. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
201. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
202. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
203. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
204. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
205. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
206. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
207. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
208. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
209. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
210. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
211. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
212. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
213. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
214. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
215. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
216. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
217. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
218. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
219. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
220. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
221. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
222. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
223. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
224. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
225. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
226. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
227. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
228. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
229. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
230. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
231. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
232. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
233. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
234. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
235. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
236. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
237. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
238. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
239. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
240. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
241. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
242. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
243. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
244. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
245. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
246. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
247. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
248. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
249. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
250. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
251. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
252. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
253. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
254. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
255. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
256. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
257. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
258. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
259. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
260. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
261. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
262. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
263. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
264. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
265. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
266. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
267. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
268. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
269. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
270. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
271. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
272. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
273. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
274. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
275. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
276. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
277. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
278. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
279. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
280. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
281. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
282. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
283. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
284. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
285. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
286. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
287. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
288. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
289. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
290. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
291. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
292. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
293. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
294. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
295. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
296. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
297. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
298. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
299. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
300. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
301. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
302. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
303. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
304. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
305. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
306. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
307. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
308. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
309. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
310. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
311. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
312. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
313. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
314. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
315. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
316. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
317. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
318. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
319. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .
320. spacer 5.64|5422864|34|NZ_CP036317|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 12, identity: 0.647
cactttccccaggaccttggttttgatcttctat CRISPR spacer
gacttgccccaggagcttggttttggcagcggca Protospacer
**** ******** **********.. .