Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031196 Staphylococcus saprophyticus strain 1A chromosome, complete genome 3 crisprs csa3,WYL,DEDDh,cas3,DinG 1 0 7 0
NZ_CP031197 Staphylococcus saprophyticus strain 1A plasmid unnamed1 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP031196
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031196_1 194354-195015 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031196_2 322430-322540 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031196_3 1588319-1588410 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP031196_1 1.8|194962|34|NZ_CP031196|CRT 194962-194995 34 NZ_CP031196.1 190408-190441 2 0.941

1. spacer 1.8|194962|34|NZ_CP031196|CRT matches to position: 190408-190441, mismatch: 2, identity: 0.941

tgagtcattaagtgagagtgagtcactaagtgca	CRISPR spacer
tgagtcattaagtgcgagtgagtcattaagtgca	Protospacer
************** **********.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1012998 : 1120122 113 Staphylococcus_phage(57.97%) tRNA,terminase,holin,protease,capsid,integrase,head,portal,tail attL 1035001:1035018|attR 1084118:1084135
DBSCAN-SWA_2 1241895 : 1251018 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 1377323 : 1387286 11 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_4 1822169 : 1830644 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_5 2076332 : 2095062 14 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_6 2103363 : 2110912 9 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_7 2465517 : 2502140 37 Staphylococcus_phage(40.0%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031197
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 98 : 30612 46 Staphylococcus_phage(67.44%) terminase,capsid,head,portal,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage