Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031281 Staphylococcus pasteuri strain 3C plasmid unnamed1, complete sequence 1 crisprs cas14j,csa3,RT 1 1 7 1
NZ_CP031280 Staphylococcus pasteuri strain 3C chromosome, complete genome 1 crisprs WYL,csa3,DEDDh,cas3,DinG 0 0 5 0

Results visualization

1. NZ_CP031281
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031281_1 82477-82698 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP031281_1 1.1|82528|120|NZ_CP031281|CRISPRCasFinder 82528-82647 120 NZ_CP031281.1 62703-62822 60 0.5

1. spacer 1.1|82528|120|NZ_CP031281|CRISPRCasFinder matches to position: 62703-62822, mismatch: 60, identity: 0.5

tagttttgccacattaaaggcatagttttgccacattaaaggcatagtttttttattgtt	CRISPR spacer
tagttttgccacattaaaggcatagttttgccacattaaaggcatagtttttttattgtt	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031281_1 1.1|82528|120|NZ_CP031281|CRISPRCasFinder 82528-82647 120 NZ_CP031281 Staphylococcus pasteuri strain 3C plasmid unnamed1, complete sequence 62703-62822 60 0.5
NZ_CP031281_1 1.1|82528|120|NZ_CP031281|CRISPRCasFinder 82528-82647 120 NZ_CP031281 Staphylococcus pasteuri strain 3C plasmid unnamed1, complete sequence 82528-82647 60 0.5

1. spacer 1.1|82528|120|NZ_CP031281|CRISPRCasFinder matches to NZ_CP031281 (Staphylococcus pasteuri strain 3C plasmid unnamed1, complete sequence) position: , mismatch: 60, identity: 0.5

tagttttgccacattaaaggcatagttttgccacattaaaggcatagtttttttattgtt	CRISPR spacer
tagttttgccacattaaaggcatagttttgccacattaaaggcatagtttttttattgtt	Protospacer
************************************************************

2. spacer 1.1|82528|120|NZ_CP031281|CRISPRCasFinder matches to NZ_CP031281 (Staphylococcus pasteuri strain 3C plasmid unnamed1, complete sequence) position: , mismatch: 60, identity: 0.5

tagttttgccacattaaaggcatagttttgccacattaaaggcatagtttttttattgtt	CRISPR spacer
tagttttgccacattaaaggcatagttttgccacattaaaggcatagtttttttattgtt	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4383 3 Lactobacillus_virus(50.0%) transposase NA
DBSCAN-SWA_2 14379 : 26236 8 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_3 39681 : 43382 3 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_4 48304 : 49294 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_5 54581 : 67235 14 Staphylococcus_phage(50.0%) tRNA,holin NA
DBSCAN-SWA_6 78114 : 90768 14 Staphylococcus_phage(50.0%) holin,tRNA NA
DBSCAN-SWA_7 95500 : 97519 3 Staphylococcus_phage(100.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP031281.1|WP_017636241.1|66363_66612_+|hypothetical-protein 66363_66612_+ 82 aa aa NA NA NA 54581-67235 yes
2. NZ_CP031280
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031280_1 918342-918441 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 992408 : 1021664 31 Staphylococcus_phage(88.0%) tRNA NA
DBSCAN-SWA_2 1153752 : 1165485 8 uncultured_Mediterranean_phage(42.86%) tRNA NA
DBSCAN-SWA_3 1738591 : 1747061 8 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_4 1939941 : 1989821 61 uncultured_Caudovirales_phage(66.07%) capsid,integrase,terminase,protease,tail attL 1930906:1930924|attR 1994664:1994682
DBSCAN-SWA_5 2021847 : 2035447 12 uncultured_Caudovirales_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage