Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024952 Helicobacter pylori strain B125A chromosome, complete genome 4 crisprs cas14j,cas3,DEDDh 0 1 0 0

Results visualization

1. NZ_CP024952
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024952_1 575705-575896 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024952_2 1226249-1226385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024952_3 1238349-1238438 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024952_4 1485615-1485739 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024952_1 1.1|575726|33|NZ_CP024952|CRT 575726-575758 33 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 465746-465778 9 0.727

1. spacer 1.1|575726|33|NZ_CP024952|CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 9, identity: 0.727

gtgtcgttattaaagctagtattgtcattaaaa	CRISPR spacer
ggggtacgtttaaagctattaatgtcattaaaa	Protospacer
* * ...  ********* ** ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage