Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024947 Helicobacter pylori strain J182 chromosome, complete genome 2 crisprs cas3,cas2 0 2 1 0

Results visualization

1. NZ_CP024947
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024947_1 555466-555605 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024947_2 1157403-1157550 Orphan I-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024947_2 2.2|1157497|26|NZ_CP024947|PILER-CR 1157497-1157522 26 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 183240-183265 5 0.808
NZ_CP024947_2 2.4|1157491|27|NZ_CP024947|CRISPRCasFinder 1157491-1157517 27 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 183240-183266 6 0.778

1. spacer 2.2|1157497|26|NZ_CP024947|PILER-CR matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 5, identity: 0.808

ggcaacgccagctttgataacgacac	CRISPR spacer
tcaagcgccagctttgatatcgacac	Protospacer
   *.************** ******

2. spacer 2.4|1157491|27|NZ_CP024947|CRISPRCasFinder matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 6, identity: 0.778

ggcaacgccagctttgataacgacacc	CRISPR spacer
tcaagcgccagctttgatatcgacacg	Protospacer
   *.************** ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 382806 : 392795 9 Streptococcus_phage(42.86%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage