Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041664 Mycoplasma anserisalpingitidis strain MYCAV177 chromosome, complete genome 1 crisprs NA 0 1 3 0

Results visualization

1. NZ_CP041664
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041664_1 464698-464786 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041664_1 1.1|464726|33|NZ_CP041664|CRISPRCasFinder 464726-464758 33 MK327140 Klebsiella phage YX3973, complete genome 30367-30399 7 0.788
NZ_CP041664_1 1.1|464726|33|NZ_CP041664|CRISPRCasFinder 464726-464758 33 NC_019507 Campylobacter phage CP21, complete genome 30922-30954 8 0.758
NZ_CP041664_1 1.1|464726|33|NZ_CP041664|CRISPRCasFinder 464726-464758 33 HE815464 Campylobacter phage CP21 complete sequence 30922-30954 8 0.758
NZ_CP041664_1 1.1|464726|33|NZ_CP041664|CRISPRCasFinder 464726-464758 33 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 552327-552359 9 0.727

1. spacer 1.1|464726|33|NZ_CP041664|CRISPRCasFinder matches to MK327140 (Klebsiella phage YX3973, complete genome) position: , mismatch: 7, identity: 0.788

ttacatgaaaatttcattaaaagtgattaaaaa	CRISPR spacer
ttacatgaaaagttcaataaaagtgtgtattac	Protospacer
*********** **** ********  **  * 

2. spacer 1.1|464726|33|NZ_CP041664|CRISPRCasFinder matches to NC_019507 (Campylobacter phage CP21, complete genome) position: , mismatch: 8, identity: 0.758

ttacatgaaaatttcattaaaagtgattaaaaa	CRISPR spacer
taaattatgaattttattaaaagtgattataaa	Protospacer
* *  *. .*****.************** ***

3. spacer 1.1|464726|33|NZ_CP041664|CRISPRCasFinder matches to HE815464 (Campylobacter phage CP21 complete sequence) position: , mismatch: 8, identity: 0.758

ttacatgaaaatttcattaaaagtgattaaaaa	CRISPR spacer
taaattatgaattttattaaaagtgattataaa	Protospacer
* *  *. .*****.************** ***

4. spacer 1.1|464726|33|NZ_CP041664|CRISPRCasFinder matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 9, identity: 0.727

ttacatgaaaatttcattaaaagtgattaaaaa	CRISPR spacer
aaatttgaaaatttaattaaaagagattatatt	Protospacer
  *. ********* ******** ***** *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 164991 : 176236 8 Mycoplasma_phage(71.43%) NA NA
DBSCAN-SWA_2 253674 : 262250 7 Aeromonas_phage(14.29%) transposase,tRNA NA
DBSCAN-SWA_3 619763 : 628720 10 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage