Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042344 Comamonas sp. NLF-7-7 strain NLF 7-7 chromosome, complete genome 4 crisprs Cas9_archaeal,csa3,DEDDh,RT,PD-DExK,DinG 0 1 2 0

Results visualization

1. NZ_CP042344
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042344_1 2309586-2309706 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042344_2 2482980-2483081 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042344_3 2670153-2670263 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042344_4 3172311-3172396 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042344_3 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder 2670191-2670225 35 MT776811 Arthrobacter phage King2, complete genome 39753-39787 10 0.714
NZ_CP042344_3 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder 2670191-2670225 35 MF324907 Arthrobacter phage Beans, complete genome 39601-39635 10 0.714
NZ_CP042344_3 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder 2670191-2670225 35 NC_041931 Arthrobacter phage Jawnski, complete genome 39386-39420 11 0.686
NZ_CP042344_3 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder 2670191-2670225 35 MF377442 Arthrobacter phage Franzy, complete genome 39877-39911 11 0.686
NZ_CP042344_3 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder 2670191-2670225 35 NC_041930 Arthrobacter phage Brent, complete genome 39861-39895 11 0.686

1. spacer 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder matches to MT776811 (Arthrobacter phage King2, complete genome) position: , mismatch: 10, identity: 0.714

agcgcgcgctcacgccgggcggcgtcgtccaccat	CRISPR spacer
atgaagcgctcacgccgggcggcgtcgacctgtgg	Protospacer
*  . ********************** **  .. 

2. spacer 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder matches to MF324907 (Arthrobacter phage Beans, complete genome) position: , mismatch: 10, identity: 0.714

agcgcgcgctcacgccgggcggcgtcgtccaccat	CRISPR spacer
acgaagcgctcacgccgggcggcgtcgacctatgg	Protospacer
*  . ********************** **  .. 

3. spacer 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder matches to NC_041931 (Arthrobacter phage Jawnski, complete genome) position: , mismatch: 11, identity: 0.686

agcgcgcgctcacgccgggcggcgtcgtccaccat	CRISPR spacer
acgaagcgctcacgccgggcggcatcgacctgtgg	Protospacer
*  . ******************.*** **  .. 

4. spacer 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder matches to MF377442 (Arthrobacter phage Franzy, complete genome) position: , mismatch: 11, identity: 0.686

agcgcgcgctcacgccgggcggcgtcgtccaccat	CRISPR spacer
acgaagcgctcacgccgggcggcatcgacctgtgg	Protospacer
*  . ******************.*** **  .. 

5. spacer 3.1|2670191|35|NZ_CP042344|CRISPRCasFinder matches to NC_041930 (Arthrobacter phage Brent, complete genome) position: , mismatch: 11, identity: 0.686

agcgcgcgctcacgccgggcggcgtcgtccaccat	CRISPR spacer
acgaagcgctcacgccgggcggcatcgacctgtgg	Protospacer
*  . ******************.*** **  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2304003 : 2379902 57 Ralstonia_phage(17.65%) integrase,protease,tRNA,transposase attL 2294819:2294839|attR 2364903:2364923
DBSCAN-SWA_2 3155116 : 3185850 40 Pseudomonas_phage(54.17%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage