Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042397 Leuconostoc citreum strain CBA3623 plasmid unnamed4, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP042394 Leuconostoc citreum strain CBA3623 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042393 Leuconostoc citreum strain CBA3623 chromosome, complete genome 0 crisprs DEDDh,cas3 0 0 8 0
NZ_CP042398 Leuconostoc citreum strain CBA3623 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042395 Leuconostoc citreum strain CBA3623 plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP042396 Leuconostoc citreum strain CBA3623 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP042397
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042397_1 17009-17167 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NZ_CP042397 Leuconostoc citreum strain CBA3623 plasmid unnamed4, complete sequence 17063-17113 0 1.0
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NZ_CP028258 Leuconostoc mesenteroides strain SRCM102735 plasmid unnamed3, complete sequence 3263-3313 4 0.922
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NZ_CP021493 Leuconostoc mesenteroides strain WiKim33 plasmid unnamed2, complete sequence 10814-10864 4 0.922
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NZ_CP021494 Leuconostoc mesenteroides strain WiKim33 plasmid unnamed3, complete sequence 10252-10302 4 0.922
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NZ_CP047631 Lactococcus raffinolactis strain Lr_18_12S plasmid pLraf_18_12S_1, complete sequence 10458-10508 4 0.922
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NZ_CP049099 Weissella confusa strain N17 plasmid p2, complete sequence 4626-4676 4 0.922
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NC_015756 Weissella koreensis KACC 15510 plasmid WKp2903, complete sequence 6956-7006 4 0.922
NZ_CP042397_1 1.1|17063|51|NZ_CP042397|CRISPRCasFinder 17063-17113 51 NC_010469 Leuconostoc citreum KM20 plasmid pLCK4, complete sequence 7525-7575 5 0.902

1. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NZ_CP042397 (Leuconostoc citreum strain CBA3623 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	Protospacer
***************************************************

2. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NZ_CP028258 (Leuconostoc mesenteroides strain SRCM102735 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.922

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tcctccatgatccatttcactgtgatccatcgcactatgattcatcttgcc	Protospacer
. * *.*********************************************

3. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NZ_CP021493 (Leuconostoc mesenteroides strain WiKim33 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.922

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tcctccatgatccatttcactgtgatccatcgcactatgattcatcttgcc	Protospacer
. * *.*********************************************

4. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NZ_CP021494 (Leuconostoc mesenteroides strain WiKim33 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.922

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tcctccatgatccatttcactgtgatccatcgcactatgattcatcttgcc	Protospacer
. * *.*********************************************

5. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NZ_CP047631 (Lactococcus raffinolactis strain Lr_18_12S plasmid pLraf_18_12S_1, complete sequence) position: , mismatch: 4, identity: 0.922

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tgcgccatgatccatttcactgtgatccatcgcactatgattcatcttgct	Protospacer
.**.*.********************************************.

6. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NZ_CP049099 (Weissella confusa strain N17 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.922

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tgcgccatgatccatttcactgtgatccatcgcactatgattcatcttgct	Protospacer
.**.*.********************************************.

7. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NC_015756 (Weissella koreensis KACC 15510 plasmid WKp2903, complete sequence) position: , mismatch: 4, identity: 0.922

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tcctccatgatccatttcactgtgatccatcgcactatgattcatcttgcc	Protospacer
. * *.*********************************************

8. spacer 1.1|17063|51|NZ_CP042397|CRISPRCasFinder matches to NC_010469 (Leuconostoc citreum KM20 plasmid pLCK4, complete sequence) position: , mismatch: 5, identity: 0.902

cgcactatgatccatttcactgtgatccatcgcactatgattcatcttgcc	CRISPR spacer
tcctccatgatccatttcactgtgatccatcgcactatgattcatcttgct	Protospacer
. * *.********************************************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP042393
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 67797 : 87502 30 Leuconostoc_phage(70.59%) integrase,transposase attL 68663:68677|attR 86965:86979
DBSCAN-SWA_2 162967 : 173267 6 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_3 345242 : 355283 8 Streptococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_4 572114 : 579710 8 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 615917 : 667955 50 unidentified_phage(31.25%) tRNA,transposase NA
DBSCAN-SWA_6 685341 : 733751 60 Streptococcus_phage(33.33%) holin,transposase NA
DBSCAN-SWA_7 1371177 : 1379066 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 1674982 : 1680809 11 Leuconostoc_phage(70.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage