Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041659 Sphingomonas sp. AE3 chromosome, complete genome 1 crisprs csa3,DinG,DEDDh 0 2 0 0

Results visualization

1. NZ_CP041659
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041659_1 1020625-1020933 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041659_1 1.2|1020703|39|NZ_CP041659|CRT 1020703-1020741 39 NZ_CP018232 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence 184470-184508 8 0.795
NZ_CP041659_1 1.5|1020880|33|NZ_CP041659|CRT 1020880-1020912 33 MG962366 Rhodococcus phage Finch, complete genome 124871-124903 9 0.727

1. spacer 1.2|1020703|39|NZ_CP041659|CRT matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.795

---aagcttggtgcaatggagggcggcaaggtcaagctggcg	CRISPR spacer
cgtgagct---cgtaatggacggcggcaaggtcaagctgacg	Protospacer
   .****   .*.****** ******************.**

2. spacer 1.5|1020880|33|NZ_CP041659|CRT matches to MG962366 (Rhodococcus phage Finch, complete genome) position: , mismatch: 9, identity: 0.727

gaggccaatgccagcgaaaacgccgaagtgtcg	CRISPR spacer
gaggccattgccagcgaaatcgccacggccaca	Protospacer
******* *********** ****. .*.  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage