Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042904 Wolbachia endosymbiont of Drosophila ananassae strain W2.1 chromosome, complete genome 11 crisprs DEDDh,RT,PD-DExK,cas3 2 1 15 1

Results visualization

1. NZ_CP042904
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_1 51700-51804 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_2 293953-294051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_3 315402-315500 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_4 345080-345184 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_5 373458-373568 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_6 805643-805957 Unclear NA
4 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_7 816279-816375 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_8 974240-974350 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_9 999290-999430 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_10 1158433-1158543 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042904_11 1281933-1282038 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP042904_7 7.1|816302|51|NZ_CP042904|CRISPRCasFinder 816302-816352 51 NZ_CP042904.1 726432-726482 1 0.98
NZ_CP042904_7 7.1|816302|51|NZ_CP042904|CRISPRCasFinder 816302-816352 51 NZ_CP042904.1 726544-726594 1 0.98
NZ_CP042904_7 7.1|816302|51|NZ_CP042904|CRISPRCasFinder 816302-816352 51 NZ_CP042904.1 726656-726706 1 0.98
NZ_CP042904_7 7.1|816302|51|NZ_CP042904|CRISPRCasFinder 816302-816352 51 NZ_CP042904.1 1158367-1158417 1 0.98
NZ_CP042904_1 1.1|51724|57|NZ_CP042904|CRISPRCasFinder 51724-51780 57 NZ_CP042904.1 901263-901319 2 0.965

1. spacer 7.1|816302|51|NZ_CP042904|CRISPRCasFinder matches to position: 726432-726482, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

2. spacer 7.1|816302|51|NZ_CP042904|CRISPRCasFinder matches to position: 726544-726594, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

3. spacer 7.1|816302|51|NZ_CP042904|CRISPRCasFinder matches to position: 726656-726706, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

4. spacer 7.1|816302|51|NZ_CP042904|CRISPRCasFinder matches to position: 1158367-1158417, mismatch: 1, identity: 0.98

agataccgcgaatgaatcgcggtatgacggtgtaatgacggttaagtaatt	CRISPR spacer
agataccgcgaatgaatcgcggtatgacggtgtaatgatggttaagtaatt	Protospacer
**************************************.************

5. spacer 1.1|51724|57|NZ_CP042904|CRISPRCasFinder matches to position: 901263-901319, mismatch: 2, identity: 0.965

ctgagataccgcgaatgaatcgcggtatgacggttcgtggcggcgtgacgataagct	CRISPR spacer
ctgagataccgcgaatgaatcgcggtatgacggttcgcggcggcatgacgataagct	Protospacer
*************************************.******.************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042904_6 6.1|805667|57|NZ_CP042904|CRT 805667-805723 57 MN180249 UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence 19772-19828 11 0.807

1. spacer 6.1|805667|57|NZ_CP042904|CRT matches to MN180249 (UNVERIFIED: Wolbachia phage WO isolate Seq2WORi_AMD2 genomic sequence) position: , mismatch: 11, identity: 0.807

gatctatgccgagataccgcggcggtatgacggttcgcggtggcatgacgataagct	CRISPR spacer
tagcggctaagagataccgtgacggtatgacggttcgcggtggcatgacgataagcc	Protospacer
 * * ..   *********.*.**********************************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29337 : 73142 39 Shigella_phage(18.18%) tail,tRNA,transposase,head NA
DBSCAN-SWA_2 77635 : 270826 174 Shigella_phage(14.29%) integrase,tRNA,transposase attL 197630:197672|attR 264490:265974
DBSCAN-SWA_3 276109 : 351753 57 Tupanvirus(20.0%) tRNA,transposase,protease,head NA
DBSCAN-SWA_4 356492 : 421393 55 Wolbachia_phage(25.0%) tRNA,transposase NA
DBSCAN-SWA_5 429350 : 473959 42 Shigella_phage(23.53%) tRNA,transposase NA
DBSCAN-SWA_6 486956 : 532712 40 uncultured_virus(18.18%) transposase,protease NA
DBSCAN-SWA_7 556855 : 608297 34 Wolbachia_phage(73.33%) terminase,transposase,tail,plate,capsid,portal,head NA
DBSCAN-SWA_8 624732 : 753609 114 Wolbachia_phage(73.77%) terminase,transposase,tail,tRNA,plate,capsid,portal,head NA
DBSCAN-SWA_9 767681 : 902790 116 Wolbachia_phage(32.14%) tRNA,transposase,protease NA
DBSCAN-SWA_10 927070 : 963655 35 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(25.0%) tRNA,transposase NA
DBSCAN-SWA_11 976854 : 1031710 56 Wolbachia_phage(18.75%) terminase,transposase,protease,tRNA,portal NA
DBSCAN-SWA_12 1041744 : 1112690 59 Wolbachia_phage(67.44%) terminase,transposase,tail,plate,capsid,portal,head NA
DBSCAN-SWA_13 1116619 : 1172667 52 Indivirus(18.18%) holin,tRNA,transposase,protease NA
DBSCAN-SWA_14 1206250 : 1221290 12 Erwinia_phage(50.0%) transposase,protease NA
DBSCAN-SWA_15 1275150 : 1314778 37 Wolbachia_phage(75.0%) terminase,transposase,tRNA,plate,capsid,portal,head NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP042904.1|WP_007551133.1|1140557_1140836_-|DUF2671-domain-containing-protein 1140557_1140836_- 92 aa aa NA NA NA 1116619-1172667 yes