Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043002 Bifidobacterium longum strain BAMA-B05 chromosome, complete genome 5 crisprs DEDDh,cas3,casR,WYL 0 1 2 0

Results visualization

1. NZ_CP043002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043002_1 175156-175239 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043002_2 933429-933513 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043002_3 1051377-1051745 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043002_4 1589965-1590050 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043002_5 2075210-2075290 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043002_3 3.2|1051461|24|NZ_CP043002|CRISPRCasFinder 1051461-1051484 24 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 98015-98038 3 0.875
NZ_CP043002_3 3.2|1051461|24|NZ_CP043002|CRISPRCasFinder 1051461-1051484 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1789555-1789578 4 0.833

1. spacer 3.2|1051461|24|NZ_CP043002|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcagccggctgcggaaccgat	CRISPR spacer
acggctgcccgctgcggaaccgat	Protospacer
 **** *** **************

2. spacer 3.2|1051461|24|NZ_CP043002|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcagccggctgcggaaccgat	CRISPR spacer
gaggcagccggcggcggaaccgac	Protospacer
  ********** **********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3271 : 14108 12 Bifidobacterium_phage(77.78%) tail,portal NA
DBSCAN-SWA_2 263834 : 299307 48 Propionibacterium_phage(45.0%) terminase,protease,integrase,portal,capsid,head attL 270342:270356|attR 307505:307519
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage