Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041022 Klebsiella pneumoniae strain KP1677 chromosome, complete genome 2 crisprs csa3,cas3,DEDDh,DinG,WYL 0 1 7 0

Results visualization

1. NZ_CP041022
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041022_1 1216592-1216686 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041022_2 4312747-4312875 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041022_1 1.1|1216621|37|NZ_CP041022|CRISPRCasFinder 1216621-1216657 37 MH178096 Aeromonas phage AsXd-1, complete genome 10850-10886 5 0.865

1. spacer 1.1|1216621|37|NZ_CP041022|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 5, identity: 0.865

aatcgttcactacctggtgcaggagattcactacctg	CRISPR spacer
aatcgttcactacctggtgcagcagattcaccccgta	Protospacer
********************** ********. * *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 665577 : 703310 45 Escherichia_phage(28.95%) plate,portal,capsid,tail,tRNA,holin,head,integrase,lysis,terminase attL 665450:665464|attR 672999:673013
DBSCAN-SWA_2 1184928 : 1293239 113 Enterobacteria_phage(27.45%) portal,transposase,capsid,tail,tRNA,head,integrase,lysis,terminase,protease attL 1200307:1200323|attR 1286781:1286797
DBSCAN-SWA_3 1710346 : 1717251 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_4 2802563 : 2813451 10 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_5 3193734 : 3284976 96 Klebsiella_phage(52.5%) portal,transposase,capsid,tail,tRNA,head,integrase,terminase attL 3186354:3186371|attR 3293241:3293258
DBSCAN-SWA_6 3534418 : 3543882 8 Brazilian_cedratvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_7 4020905 : 4074898 72 Cronobacter_phage(21.28%) tRNA,head,coat,integrase,lysis,terminase,protease attL 4016650:4016695|attR 4062145:4062190
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage