Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043225 Enterobacter hormaechei strain PG20180056 chromosome, complete genome 2 crisprs DEDDh,csa3,WYL,DinG,cas3 0 1 5 0

Results visualization

1. NZ_CP043225
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043225_1 1612340-1612428 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043225_2 2732308-2732432 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21037-21067 6 0.806
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26631-26661 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534695 7 0.774
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62534-62564 8 0.742
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283176 8 0.742
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22328-22358 9 0.71
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475129 9 0.71
NZ_CP043225_1 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder 1612369-1612399 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714216 10 0.677

1. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 6, identity: 0.806

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcattgt	Protospacer
**********.** ********* *..** *

2. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

3. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

4. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

5. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

6. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

7. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

8. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

9. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

10. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

11. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccag----cgtgtttt	CRISPR spacer
acggcgagaccgtcacgcgccaggtgccggg----	Protospacer
******* **** **********    ** *    

12. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
gcggcgacaccgacactcgcccgcgatctca	Protospacer
.*************** **** ***  .*. 

13. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
tcggcgatgccgacacgcgccagcagttcta	Protospacer
 ******..***************.  *.* 

14. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacatcgacacgcggcagcccaggat	Protospacer
 ********.********* **** ..   *

15. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacaccgacacccggcagcccaggat	Protospacer
 *************** ** **** ..   *

16. spacer 1.1|1612369|31|NZ_CP043225|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ggggcgactccgacccgcgccagcgccgcag	Protospacer
. ****** ***** **********.  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 562256 : 575935 14 Enterobacteria_phage(77.78%) integrase attL 552280:552293|attR 569706:569719
DBSCAN-SWA_2 1114289 : 1183011 77 Enterobacteria_phage(48.78%) transposase,head,capsid,terminase,plate,tRNA,protease,integrase,tail,portal attL 1130731:1130759|attR 1186542:1186570
DBSCAN-SWA_3 2677402 : 2742076 75 Escherichia_phage(15.38%) holin,head,terminase,tRNA,protease,tail,portal NA
DBSCAN-SWA_4 2902745 : 2911992 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_5 3401043 : 3501386 110 Escherichia_phage(27.78%) holin,capsid,head,terminase,lysis,plate,tRNA,integrase,tail,portal attL 3476654:3476670|attR 3497962:3497978
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage