Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041643 Olivibacter sp. LS-1 chromosome, complete genome 7 crisprs PD-DExK,WYL,csa3,DEDDh,DinG,cas3 1 0 1 0

Results visualization

1. NZ_CP041643
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_1 629582-629685 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_2 1947985-1948117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_3 1990018-1990134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_4 2006886-2006975 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_5 2342745-2342868 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_6 4281442-4281573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041643_7 5734474-5734557 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP041643_3 3.1|1990049|55|NZ_CP041643|CRISPRCasFinder 1990049-1990103 55 NZ_CP041643.1 5201236-5201290 2 0.964

1. spacer 3.1|1990049|55|NZ_CP041643|CRISPRCasFinder matches to position: 5201236-5201290, mismatch: 2, identity: 0.964

ccatcatgatttattcaaaccacacaggggtatgaatgaatctgatagcttcatc	CRISPR spacer
ccatcatgatttattcaaaccacacaggggaatgaataaatctgatagcttcatc	Protospacer
****************************** ******.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2454053 : 2483952 51 uncultured_Mediterranean_phage(14.29%) capsid,portal,protease,tail,head,terminase,integrase attL 2448309:2448324|attR 2461823:2461838
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage