Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022579 Oryzomicrobium terrae strain TPP412 chromosome, complete genome 1 crisprs csa3,cas3,Cas9_archaeal,DEDDh,WYL,DinG,cas4 0 1 4 0

Results visualization

1. NZ_CP022579
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022579_1 2674122-2674198 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP020529 Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence 72320-72350 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP038299 Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence 32379-32409 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP037947 Escherichia coli strain CFSAN027346 plasmid pCFSAN027346-2, complete sequence 9683-9713 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP020057 Escherichia coli strain AR_0069 plasmid unitig_3, complete sequence 18452-18482 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 64529-64559 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP023351 Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence 67489-67519 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 152885-152915 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP029104 Escherichia coli strain AR437 plasmid unnamed2, complete sequence 20814-20844 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_AP014804 Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence 65484-65514 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP044149 Escherichia coli O157 strain AR-0427 plasmid pAR-0427-1 5414-5444 6 0.806
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 17890-17920 7 0.774
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP039632 Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence 92584-92614 7 0.774
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_CP007510 Pseudomonas stutzeri strain 19SMN4 plasmid pLIB119, complete plasmid 78434-78464 7 0.774
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NC_008275 Pseudomonas putida MT53 plasmid pWW53, complete sequence 55871-55901 7 0.774
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 48847-48877 7 0.774
NZ_CP022579_1 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder 2674145-2674175 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 66710-66740 8 0.742

1. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

2. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP038299 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

3. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP037947 (Escherichia coli strain CFSAN027346 plasmid pCFSAN027346-2, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

4. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP020057 (Escherichia coli strain AR_0069 plasmid unitig_3, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

5. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

6. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP023351 (Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

7. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

8. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP029104 (Escherichia coli strain AR437 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

9. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_AP014804 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

10. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP044149 (Escherichia coli O157 strain AR-0427 plasmid pAR-0427-1) position: , mismatch: 6, identity: 0.806

gtcaggt--cgccgccggtttccacgccccagc	CRISPR spacer
--cggcttgcgccgccgattaccacgccccagc	Protospacer
  *.* *  ********.** ************

11. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.774

gtcaggtcgccgccggtttccacgccc-cagc	CRISPR spacer
ccgccgtcgccgccggtttcctcgcccgcag-	Protospacer
 .   **************** ***** *** 

12. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP039632 (Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

gtcaggtcgccgccggtttccacgccccagc	CRISPR spacer
tagaggtcgatgccggtttccacgcccatgc	Protospacer
   ****** .****************  **

13. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_CP007510 (Pseudomonas stutzeri strain 19SMN4 plasmid pLIB119, complete plasmid) position: , mismatch: 7, identity: 0.774

gtcaggtcgccgccggtttccacgccccagc	CRISPR spacer
tagaggtcgatgccggtttccacgcccatgc	Protospacer
   ****** .****************  **

14. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NC_008275 (Pseudomonas putida MT53 plasmid pWW53, complete sequence) position: , mismatch: 7, identity: 0.774

gtcaggtcgccgccggtttccacgccccagc	CRISPR spacer
tagaggtcgatgccggtttccacgcccatgc	Protospacer
   ****** .****************  **

15. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 7, identity: 0.774

gtcaggtcgccgccggtttccacgccccagc	CRISPR spacer
tagaggtcgatgccggtttccacgcccatgc	Protospacer
   ****** .****************  **

16. spacer 1.1|2674145|31|NZ_CP022579|CRISPRCasFinder matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 8, identity: 0.742

gtcaggtcgccgccggtttccacgccccagc	CRISPR spacer
gtacggtggccgccggtttcgacgcccgcca	Protospacer
**  *** ************ ******    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1420736 : 1431012 9 Pseudomonas_phage(71.43%) NA NA
DBSCAN-SWA_2 1447084 : 1462352 15 Pseudomonas_phage(11.11%) holin NA
DBSCAN-SWA_3 1502622 : 1514456 11 Leptospira_phage(14.29%) integrase NA
DBSCAN-SWA_4 3150524 : 3158318 8 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage