Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042910 Gimesia maris strain DSM 8797 chromosome, complete genome 2 crisprs csa3,RT,cas3,DinG,WYL 1 1 2 0

Results visualization

1. NZ_CP042910
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042910_1 4538415-4538494 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042910_2 6915002-6915189 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP042910_1 1.1|4538438|34|NZ_CP042910|CRISPRCasFinder 4538438-4538471 34 NZ_CP042910.1 888750-888783 1 0.971
NZ_CP042910_1 1.1|4538438|34|NZ_CP042910|CRISPRCasFinder 4538438-4538471 34 NZ_CP042910.1 1232999-1233032 1 0.971

1. spacer 1.1|4538438|34|NZ_CP042910|CRISPRCasFinder matches to position: 888750-888783, mismatch: 1, identity: 0.971

cgaacggttgtgtatcatgtgtccggtcttaata	CRISPR spacer
cgaacggttgtgtatcatgtgtccggtctaaata	Protospacer
***************************** ****

2. spacer 1.1|4538438|34|NZ_CP042910|CRISPRCasFinder matches to position: 1232999-1233032, mismatch: 1, identity: 0.971

cgaacggttgtgtatcatgtgtccggtcttaata	CRISPR spacer
cgaacggttgtgtatcatgtgtccggtctaaata	Protospacer
***************************** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042910_2 2.2|6915097|25|NZ_CP042910|CRISPRCasFinder 6915097-6915121 25 NZ_CP015734 Arthrobacter sp. U41 plasmid unnamed2, complete sequence 70766-70790 5 0.8
NZ_CP042910_2 2.2|6915097|25|NZ_CP042910|CRISPRCasFinder 6915097-6915121 25 NZ_CP015734 Arthrobacter sp. U41 plasmid unnamed2, complete sequence 163652-163676 5 0.8

1. spacer 2.2|6915097|25|NZ_CP042910|CRISPRCasFinder matches to NZ_CP015734 (Arthrobacter sp. U41 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

cgtcgccgacgattccagcccgatg	CRISPR spacer
ggtcgccgacgatgccagcccggcc	Protospacer
 ************ ********.. 

2. spacer 2.2|6915097|25|NZ_CP042910|CRISPRCasFinder matches to NZ_CP015734 (Arthrobacter sp. U41 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

cgtcgccgacgattccagcccgatg	CRISPR spacer
ggtcgccgacgatgccagcccggcc	Protospacer
 ************ ********.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2436059 : 2536522 49 Wolbachia_phage(20.0%) transposase NA
DBSCAN-SWA_2 6049596 : 6055490 6 Bacillus_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage