Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043562 Klebsiella pneumoniae strain P094-1 chromosome, complete genome 2 crisprs csa3,cas3,DEDDh,DinG,WYL 0 1 5 0

Results visualization

1. NZ_CP043562
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043562_1 278986-279084 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043562_2 1878783-1878872 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043562_1 1.1|279023|25|NZ_CP043562|CRISPRCasFinder 279023-279047 25 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 228012-228036 0 1.0

1. spacer 1.1|279023|25|NZ_CP043562|CRISPRCasFinder matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 0, identity: 1.0

ctttatgccgttatgttgtcttttg	CRISPR spacer
ctttatgccgttatgttgtcttttg	Protospacer
*************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1844914 : 1896133 68 Cronobacter_phage(24.49%) integrase,head,holin,terminase,tail,transposase attL 1846177:1846195|attR 1862552:1862570
DBSCAN-SWA_2 2529824 : 2540711 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_3 2932141 : 2940065 11 Phage_21(37.5%) integrase attL 2926812:2926825|attR 2942764:2942777
DBSCAN-SWA_4 3213035 : 3222498 8 Brazilian_cedratvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_5 4318391 : 4372379 53 Sodalis_phage(14.29%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage