Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023688 Streptomyces rimosus strain ATCC 10970 chromosome, complete genome 10 crisprs csa3,RT,cas8e,DEDDh,DinG,WYL,cas3,cas4,casR 0 3 6 0

Results visualization

1. NZ_CP023688
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_1 984678-984860 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_2 1720204-1720352 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_3 2659543-2659627 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_4 2817945-2818032 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_5 4479372-4479473 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_6 6139293-6139406 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_7 6402664-6402850 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_8 6426760-6426867 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_9 6832531-6832630 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023688_10 7640789-7640864 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023688_3 3.1|2659567|37|NZ_CP023688|CRISPRCasFinder 2659567-2659603 37 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 334970-335006 6 0.838
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 253740-253787 6 0.875
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 39311-39340 7 0.767
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 MG945689 UNVERIFIED: Microviridae sp. isolate 1391-18011, complete genome 1175-1204 7 0.767
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 167002-167031 7 0.767
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP012163 Enterobacter roggenkampii strain 35734 plasmid p35734-109.753kb, complete sequence 40899-40928 8 0.733
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP009851 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-c88, complete sequence 28228-28257 8 0.733
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 310516-310545 8 0.733
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 308554-308583 8 0.733
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 308886-308915 8 0.733
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 10119-10148 8 0.733
NZ_CP023688_10 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder 7640812-7640841 30 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 1016-1045 8 0.733
NZ_CP023688_3 3.1|2659567|37|NZ_CP023688|CRISPRCasFinder 2659567-2659603 37 NZ_CP015091 Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence 75411-75447 9 0.757
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 KY250482 Corynebacterium phage phi16, complete genome 56101-56148 9 0.812
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 KF017927 Mycobacterium phage Odin, complete genome 4126-4173 9 0.812
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 MN284903 Mycobacterium phage GaugeLDP, complete genome 5561-5608 9 0.812
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 MK359341 Mycobacterium phage GingkoMaracino, complete genome 3702-3749 10 0.792
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 MH536825 Mycobacterium phage Ollie, complete genome 3702-3749 10 0.792
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 MN284900 Mycobacterium phage JeppNRM, complete genome 3867-3914 10 0.792
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 MH450128 Mycobacterium phage Reba, complete genome 3540-3587 10 0.792
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 MH371121 Mycobacterium phage Phranny, complete genome 3867-3914 10 0.792
NZ_CP023688_8 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder 6426790-6426837 48 KF279418 Mycobacterium phage Anubis, complete genome 3702-3749 10 0.792

1. spacer 3.1|2659567|37|NZ_CP023688|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.838

acgcggtcggcgtgcgcgccgtcgcccaccgcgccga---	CRISPR spacer
acgccgtcggcctgcgcgccgtcgc---cctcgccgaatc	Protospacer
**** ****** *************   ** ******   

2. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 6, identity: 0.875

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ttgatcccctgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
*.*.**************************..**************. 

3. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.767

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
tccccgccaagcccgccgccggcgcgaccg	Protospacer
.* *** ************ ******  *.

4. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to MG945689 (UNVERIFIED: Microviridae sp. isolate 1391-18011, complete genome) position: , mismatch: 7, identity: 0.767

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
gcgctgtcaaggccgccgcaggcgcgtagc	Protospacer
 *.*.* **** ****************  

5. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.767

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
tccccgccaagcccgccgccggcgcgaccg	Protospacer
.* *** ************ ******  *.

6. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP012163 (Enterobacter roggenkampii strain 35734 plasmid p35734-109.753kb, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
acggcgacaaacccgccgcaggcgcggtgt	Protospacer
 *. ******.***************    

7. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP009851 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-c88, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
acggcgacaaacccgccgcaggcgcggtgt	Protospacer
 *. ******.***************    

8. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
gcaccggcaagcccgccccaggcggtctcg	Protospacer
 *****.********** ******  . *.

9. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
gcaccggcaagcccgccccaggcggtctcg	Protospacer
 *****.********** ******  . *.

10. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
gcaccggcaagcccgccccaggcggtctcg	Protospacer
 *****.********** ******  . *.

11. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
ccaccgacaagaccgccgcagctaccccaa	Protospacer
*********** ********* ..* .  *

12. spacer 10.1|7640812|30|NZ_CP023688|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.733

ccaccgacaagcccgccgcaggcgcgtaca	CRISPR spacer
gcaccggcaagcccgccccaggcggtctcg	Protospacer
 *****.********** ******  . *.

13. spacer 3.1|2659567|37|NZ_CP023688|CRISPRCasFinder matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 9, identity: 0.757

---acgcggtcggcgtgcgcgccgtcgcccaccgcgccga	CRISPR spacer
gaggcgagatcga---gcgcgccgtcgcccaccgcgtcgt	Protospacer
   .** *.***.   ********************.** 

14. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to KY250482 (Corynebacterium phage phi16, complete genome) position: , mismatch: 9, identity: 0.812

---tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
caattgatcat---tagctcaattggcagagcatccggctgttaaccggac	Protospacer
   *.*.** .   ********************.*************** 

15. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to KF017927 (Mycobacterium phage Odin, complete genome) position: , mismatch: 9, identity: 0.812

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccaatgacgtgtagctcaattggcagagcacccggctgttaaccggac	Protospacer
.*..*  * *********************..*************** 

16. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to MN284903 (Mycobacterium phage GaugeLDP, complete genome) position: , mismatch: 9, identity: 0.812

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccactgacgtgtagctcaatcggcagagcatccggctgttaaccggac	Protospacer
.*. *  * ***********.**********.*************** 

17. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to MK359341 (Mycobacterium phage GingkoMaracino, complete genome) position: , mismatch: 10, identity: 0.792

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccactgacgtgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
.*. *  * *********************..**************. 

18. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to MH536825 (Mycobacterium phage Ollie, complete genome) position: , mismatch: 10, identity: 0.792

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccactgacgtgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
.*. *  * *********************..**************. 

19. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to MN284900 (Mycobacterium phage JeppNRM, complete genome) position: , mismatch: 10, identity: 0.792

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccattgacgtgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
.*. *  * *********************..**************. 

20. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to MH450128 (Mycobacterium phage Reba, complete genome) position: , mismatch: 10, identity: 0.792

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccattgacgtgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
.*. *  * *********************..**************. 

21. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to MH371121 (Mycobacterium phage Phranny, complete genome) position: , mismatch: 10, identity: 0.792

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccattgacgtgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
.*. *  * *********************..**************. 

22. spacer 8.1|6426790|48|NZ_CP023688|CRISPRCasFinder matches to KF279418 (Mycobacterium phage Anubis, complete genome) position: , mismatch: 10, identity: 0.792

tcggtcccctgtagctcaattggcagagcattcggctgttaaccggag	CRISPR spacer
ccactgacgtgtagctcaattggcagagcacccggctgttaaccgggc	Protospacer
.*. *  * *********************..**************. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 823841 : 892841 52 Salisaeta_icosahedral_phage(16.67%) tail,transposase,protease NA
DBSCAN-SWA_2 1784689 : 1790986 7 Caulobacter_phage(16.67%) NA NA
DBSCAN-SWA_3 5397718 : 5403196 6 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_4 5420283 : 5446024 31 Streptomyces_phage(41.18%) terminase,capsid,head,portal,protease NA
DBSCAN-SWA_5 6658177 : 6665278 9 Streptomyces_phage(83.33%) portal,capsid NA
DBSCAN-SWA_6 6682143 : 6689851 15 Gordonia_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage