Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023689 Streptomyces chartreusis strain ATCC 14922 chromosome, complete genome 19 crisprs csa3,DEDDh,DinG,Cas14u_CAS-V,WYL,cas3,Cas9_archaeal,c2c9_V-U4,cas4,casR 3 1 2 0

Results visualization

1. NZ_CP023689
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_1 3351843-3351903 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_2 3811582-3811683 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_3 3823201-3823303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_4 4063136-4063300 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_5 4921098-4921201 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_6 5108364-5108459 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_7 5172510-5172743 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_8 5299967-5300068 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_9 5384010-5384103 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_10 5721160-5721261 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_11 5819625-5819751 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_12 6068593-6068712 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_13 6188516-6188608 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_14 6907920-6908023 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_15 6958258-6958375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_16 7128401-7128495 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_17 7417972-7418060 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_18 7680383-7680496 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023689_19 7745499-7745600 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023689_7 7.1|5172552|21|NZ_CP023689|CRT 5172552-5172572 21 NZ_CP023689.1 5172873-5172893 0 1.0
NZ_CP023689_7 7.2|5172615|18|NZ_CP023689|CRT 5172615-5172632 18 NZ_CP023689.1 5172744-5172761 1 0.944
NZ_CP023689_7 7.3|5172675|27|NZ_CP023689|CRT 5172675-5172701 27 NZ_CP023689.1 5172771-5172797 1 0.963

1. spacer 7.1|5172552|21|NZ_CP023689|CRT matches to position: 5172873-5172893, mismatch: 0, identity: 1.0

ttccttcgagcgccgggacaa	CRISPR spacer
ttccttcgagcgccgggacaa	Protospacer
*********************

2. spacer 7.2|5172615|18|NZ_CP023689|CRT matches to position: 5172744-5172761, mismatch: 1, identity: 0.944

cggccgttcgttcgacgg	CRISPR spacer
cggccgttccttcgacgg	Protospacer
********* ********

3. spacer 7.3|5172675|27|NZ_CP023689|CRT matches to position: 5172771-5172797, mismatch: 1, identity: 0.963

tgggcgttccttcgagcgtcgcgacgg	CRISPR spacer
tgggcgttcgttcgagcgtcgcgacgg	Protospacer
********* *****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023689_7 7.3|5172675|27|NZ_CP023689|CRT 5172675-5172701 27 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1242620-1242646 6 0.778

1. spacer 7.3|5172675|27|NZ_CP023689|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.778

tgggcgttccttcgagcgtcgcgacgg	CRISPR spacer
atcgcgtgccttcgagcgtcgcgccga	Protospacer
   **** *************** **.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1467275 : 1479082 24 Mycobacterium_phage(22.22%) NA NA
DBSCAN-SWA_2 8595507 : 8668623 57 Bacillus_phage(11.11%) plate,tail,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage