Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044161 Campylobacter coli strain AR-0420 chromosome, complete genome 1 crisprs DEDDh,WYL,csa3 0 1 3 0

Results visualization

1. NZ_CP044161
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044161_1 1394723-1394796 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044161_1 1.1|1394746|28|NZ_CP044161|CRISPRCasFinder 1394746-1394773 28 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 452329-452356 7 0.75
NZ_CP044161_1 1.1|1394746|28|NZ_CP044161|CRISPRCasFinder 1394746-1394773 28 MT774404 CrAssphage cr114_1, complete genome 25456-25483 7 0.75

1. spacer 1.1|1394746|28|NZ_CP044161|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.75

tttattgatgaagttttgatttataagg	CRISPR spacer
attattgatgaagtattgattaattgat	Protospacer
 ************* ****** ** .. 

2. spacer 1.1|1394746|28|NZ_CP044161|CRISPRCasFinder matches to MT774404 (CrAssphage cr114_1, complete genome) position: , mismatch: 7, identity: 0.75

tttattgatgaagttttgatttataagg	CRISPR spacer
ggtattgattatgttttgatttatattc	Protospacer
  ******* * *************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 253758 : 261444 12 Campylobacter_phage(87.5%) NA NA
DBSCAN-SWA_2 1366785 : 1374329 6 Acinetobacter_phage(16.67%) NA NA
DBSCAN-SWA_3 1491567 : 1496471 6 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage