1. spacer 2.5|1554796|32|NZ_CP044200|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gttacgccgggccaggtgagagacgttacatc CRISPR spacer
gttacgccgggccaggtgagagacgttacatc Protospacer
********************************
2. spacer 1.17|1535355|32|NZ_CP044200|CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 2, identity: 0.938
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
accgggcgttgcgcgaagtgctgcggaccatt Protospacer
*************** ** *************
3. spacer 1.17|1535355|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 2, identity: 0.938
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
accgggcgttgcgcgaagtgctgcggaccatt Protospacer
*************** ** *************
4. spacer 1.17|1535355|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 2, identity: 0.938
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
accgggcgttgcgcgaagtgctgcggaccatt Protospacer
*************** ** *************
5. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttttcggctcggcgcaatatcccggcgcacgc Protospacer
**.***** ***********************
6. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttttcggctcggcgcaatatcccggcgcacgc Protospacer
**.***** ***********************
7. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP046005 (Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttttcggctcggcgcaatatcccggcgcacgc Protospacer
**.***** ***********************
8. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttctcggctcggcgcaatatccctgcgcacgc Protospacer
******** ************** ********
9. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MG592538 (Vibrio phage 1.171.O._10N.261.52.F12, partial genome) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttctcggctcggcgcagtatcccggcgcacgc Protospacer
******** *******.***************
10. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttctcggctcggcgcaatatccctgcgcacgc Protospacer
******** ************** ********
11. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045723 (Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938
agtcttccaataacacaaccagactttgccca CRISPR spacer
tgtcttccaataacacaaccagactttggcca Protospacer
*************************** ***
12. spacer 1.76|1535357|32|NZ_CP044200|PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 2, identity: 0.938
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
accgggcgttgcgcgaagtgctgcggaccatt Protospacer
*************** ** *************
13. spacer 1.76|1535357|32|NZ_CP044200|PILER-CR matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 2, identity: 0.938
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
accgggcgttgcgcgaagtgctgcggaccatt Protospacer
*************** ** *************
14. spacer 1.76|1535357|32|NZ_CP044200|PILER-CR matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 2, identity: 0.938
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
accgggcgttgcgcgaagtgctgcggaccatt Protospacer
*************** ** *************
15. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttttcggctcggcgcaatatcccggcgcacgc Protospacer
**.***** ***********************
16. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttttcggctcggcgcaatatcccggcgcacgc Protospacer
**.***** ***********************
17. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP046005 (Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttttcggctcggcgcaatatcccggcgcacgc Protospacer
**.***** ***********************
18. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttctcggctcggcgcaatatccctgcgcacgc Protospacer
******** ************** ********
19. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to MG592538 (Vibrio phage 1.171.O._10N.261.52.F12, partial genome) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttctcggctcggcgcagtatcccggcgcacgc Protospacer
******** *******.***************
20. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 2, identity: 0.938
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttctcggctcggcgcaatatccctgcgcacgc Protospacer
******** ************** ********
21. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tgctttctttttgaagataccgaacatagtga Protospacer
**************.***** **********
22. spacer 1.6|1534684|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP042168 (Burkholderia contaminans strain ZCC plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gaccatc--atttcccctgccagcgcgcgcgatt CRISPR spacer
--ccatcggacttcccctgccagctcgcgcgatt Protospacer
***** *.************* *********
23. spacer 1.6|1534684|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP046611 (Burkholderia contaminans strain XL73 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gaccatc--atttcccctgccagcgcgcgcgatt CRISPR spacer
--ccatcggacttcccctgccagctcgcgcgatt Protospacer
***** *.************* *********
24. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
25. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021537 (Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
26. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
27. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
28. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
29. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP042508 (Leclercia adecarboxylata strain E1 plasmid pE1_003, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttgactgcgcggcgtaatatcccggcgcacgc Protospacer
** * ********.*****************
30. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP040893 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_2, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttgactgcgcggcgtaatatcccggcgcacgc Protospacer
** * ********.*****************
31. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 4, identity: 0.875
agctttctttttgaaaatacctaacatagtga CRISPR spacer
ggttttctttttgaaaataccaaacatcgtga Protospacer
.*.****************** ***** ****
32. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011616 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-118, complete sequence) position: , mismatch: 4, identity: 0.875
agctttctttttgaaaatacctaacatagtga- CRISPR spacer
aactttctttttaaaaataccgaacat-gtgat Protospacer
*.**********.******** ***** ****
33. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017931 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-111, complete sequence) position: , mismatch: 4, identity: 0.875
agctttctttttgaaaatacctaacatagtga- CRISPR spacer
aactttctttttaaaaataccgaacat-gtgat Protospacer
*.**********.******** ***** ****
34. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011594 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-111, complete sequence) position: , mismatch: 4, identity: 0.875
agctttctttttgaaaatacctaacatagtga- CRISPR spacer
aactttctttttaaaaataccgaacat-gtgat Protospacer
*.**********.******** ***** ****
35. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018360 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-111, complete sequence) position: , mismatch: 4, identity: 0.875
agctttctttttgaaaatacctaacatagtga- CRISPR spacer
aactttctttttaaaaataccgaacat-gtgat Protospacer
*.**********.******** ***** ****
36. spacer 1.65|1534686|32|NZ_CP044200|PILER-CR matches to NZ_CP042168 (Burkholderia contaminans strain ZCC plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gaccatc--atttcccctgccagcgcgcgcgatt CRISPR spacer
--ccatcggacttcccctgccagctcgcgcgatt Protospacer
***** *.************* *********
37. spacer 1.65|1534686|32|NZ_CP044200|PILER-CR matches to NZ_CP046611 (Burkholderia contaminans strain XL73 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gaccatc--atttcccctgccagcgcgcgcgatt CRISPR spacer
--ccatcggacttcccctgccagctcgcgcgatt Protospacer
***** *.************* *********
38. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
39. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP021537 (Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
40. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
41. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
42. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcctctgctcggcgcaatatcccggcgcacgc Protospacer
.*** ** ***********************
43. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP042508 (Leclercia adecarboxylata strain E1 plasmid pE1_003, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttgactgcgcggcgtaatatcccggcgcacgc Protospacer
** * ********.*****************
44. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP040893 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_2, complete sequence) position: , mismatch: 4, identity: 0.875
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
ttgactgcgcggcgtaatatcccggcgcacgc Protospacer
** * ********.*****************
45. spacer 1.38|1536636|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 5, identity: 0.844
acattccccttttgaatcaatgtt---aaatcgcg CRISPR spacer
acattctccttttgaatcaattttttaaaatc--- Protospacer
******.************** ** *****
46. spacer 1.49|1537307|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP017663 (Cronobacter sp. JZ38 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
-aaaatcgccccctgcatcgatagcgattaact CRISPR spacer
gagagtcgcccctt-catcgatagcgataaact Protospacer
*.*.*******.* ************* ****
47. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.844
-acggcaacggatgcgaccgccagcgcgatccc CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatctc Protospacer
.**** ******* *.**************.*
48. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
-acggcaacggatgcgaccgccagcgcgatccc CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatctc Protospacer
.**** ******* *.**************.*
49. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844
-acggcaacggatgcgaccgccagcgcgatccc CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatctc Protospacer
.**** ******* *.**************.*
50. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_004688 (Mycobacterium phage Omega, complete genome) position: , mismatch: 6, identity: 0.812
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
actgagcgtccagcactcgccaggcgaggcca Protospacer
*.******** **************** . *
51. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 6, identity: 0.812
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
actgagcgtccagcactcgccaggcgaggcca Protospacer
*.******** **************** . *
52. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 6, identity: 0.812
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
actgagcgtccagcactcgccaggcgaggcca Protospacer
*.******** **************** . *
53. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AY129338 (Mycobacterium virus Omega, complete genome) position: , mismatch: 6, identity: 0.812
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
actgagcgtccagcactcgccaggcgaggcca Protospacer
*.******** **************** . *
54. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN855708 (Bacteriophage sp. isolate 30, complete genome) position: , mismatch: 6, identity: 0.812
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
attgagcgtcaagcactcgccatgcgagacta Protospacer
**********.*********** **** * .
55. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
tgacggctggcgcggcgtctgca--ccagcggcg CRISPR spacer
tgacggctggctcggcatctgcatgccggagg-- Protospacer
*********** ****.****** **.* **
56. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812
tgacggctggcgcggcgtctgca--ccagcggcg CRISPR spacer
tgacggctggctcggcatctgcatgccggagg-- Protospacer
*********** ****.****** **.* **
57. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
ccgccgattgctgcgcctgccgcgccgaatgc Protospacer
***************** ***.****.* .*
58. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012254 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS1, complete sequence) position: , mismatch: 6, identity: 0.812
agctttctttttgaaaatacctaacatagtga- CRISPR spacer
cgttttcttttttaaaaaacctaacat-gtgtt Protospacer
*.********* **** ********* ***
59. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027108 (Cronobacter sakazakii strain CS-931 plasmid pCsaCS931a, complete sequence) position: , mismatch: 6, identity: 0.812
agctttctttttgaaaatacctaacatagtga- CRISPR spacer
cgttttcttttttaaaaaacctaacat-gtgtt Protospacer
*.********* **** ********* ***
60. spacer 1.93|1536514|33|NZ_CP044200|PILER-CR matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 6, identity: 0.818
ccgccgattgctgcgccagccacgccaatgacc CRISPR spacer
ccgccgattgctgcgcctgccgcgccgaatgcc Protospacer
***************** ***.****.* .**
61. spacer 1.95|1536636|33|NZ_CP044200|PILER-CR matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 6, identity: 0.818
acattccccttttgaatcaatgtt---aaatcgcgc CRISPR spacer
acattctccttttgaatcaattttttaaaatcc--- Protospacer
******.************** ** *****
62. spacer 1.106|1537307|33|NZ_CP044200|PILER-CR matches to NZ_CP017663 (Cronobacter sp. JZ38 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
-aaaatcgccccctgcatcgatagcgattaactc CRISPR spacer
gagagtcgcccctt-catcgatagcgataaactt Protospacer
*.*.*******.* ************* ****.
63. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 6, identity: 0.812
-acggcaacggatgcgaccgccagcgcgatccc CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatctg Protospacer
.**** ******* *.**************.
64. spacer 1.16|1535294|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 7, identity: 0.781
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcgc Protospacer
*****.*********** ***** * ***
65. spacer 1.16|1535294|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 7, identity: 0.781
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcgc Protospacer
*****.*********** ***** * ***
66. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ttctcggcgcggcgcaatatcccggc-gcacgc CRISPR spacer
ctggcggcgcggggcaatatcgcggcggcatg- Protospacer
.* ******** ******** **** ***.*
67. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ttctcggcgcggcgcaatatcccggc-gcacgc CRISPR spacer
ctggcggcgcggggcaatatcgcggcggcatg- Protospacer
.* ******** ******** **** ***.*
68. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 7, identity: 0.781
ttctcggcgcggcgcaatatcccggc-gcacgc CRISPR spacer
ctggcggcgcggggcaatatcgcggcggcatg- Protospacer
.* ******** ******** **** ***.*
69. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP032704 (Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tcagcgcaatcagcgaaacggtcagctctact--- CRISPR spacer
tcagcgcaatcagcgaataggt---ctccagtgga Protospacer
***************** *** ***.* *
70. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MH238467 (Pasteurella phage Pm86, complete genome) position: , mismatch: 7, identity: 0.781
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
attgagcatcgagaactcgccagcagattgtt Protospacer
*******.***** ********* **. *.*
71. spacer 1.24|1535782|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
tgcgcaatgtccccgggcgggtggtgtcgctg CRISPR spacer
tgccgccggtcgccgggcaggtggtgtcgctg Protospacer
*** *** ******.*************
72. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
-tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
ctggc-gctggcgcgtcgtgtgcaccagcagta Protospacer
**.* ********* *** *********.*..
73. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781
-tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
ctggc-gctggcgcgtcgtgtgcaccagcagta Protospacer
**.* ********* *** *********.*..
74. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
cgcccgcgcgcgcggcgtcagccccagcggcg Protospacer
.* * ** ********** ** *********
75. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 7, identity: 0.781
tgacggctg-gcgcggcgtctgcaccagcggcg CRISPR spacer
-gccaggtacgcgcggcgtcggcaccaacggcg Protospacer
* *.* *. ********** ******.*****
76. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.781
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
ccgccgattgttgcgccaggcacggcgaagcg Protospacer
**********.******** **** *.* *
77. spacer 1.37|1536575|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.781
gttgcggccagccttgcggatcagctcatggg CRISPR spacer
gatgcggctcgccttgcggatcagcgccggcg Protospacer
* ******. *************** * * *
78. spacer 1.37|1536575|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 7, identity: 0.781
gttgcggccagccttgcggatcagctcatggg CRISPR spacer
gatgcggctcgccttgcggatcagcgccggcg Protospacer
* ******. *************** * * *
79. spacer 1.37|1536575|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 7, identity: 0.781
gttgcggccagccttgcggatcagctcatggg CRISPR spacer
gatgcggctcgccttgcggatcagcgccggcg Protospacer
* ******. *************** * * *
80. spacer 1.42|1536880|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN693696 (Marine virus AFVG_250M1082, complete genome) position: , mismatch: 7, identity: 0.781
ttacagacc----tcctttaaaccatttttcatttg CRISPR spacer
----aaaccaggatcctttaaacgctttttcatttg Protospacer
*.*** ********** ***********
81. spacer 1.42|1536880|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN694110 (Marine virus AFVG_250M1083, complete genome) position: , mismatch: 7, identity: 0.781
ttacagacc----tcctttaaaccatttttcatttg CRISPR spacer
----aaaccaggatcctttaaacgctttttcatttg Protospacer
*.*** ********** ***********
82. spacer 1.42|1536880|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN694066 (Marine virus AFVG_250M1081, complete genome) position: , mismatch: 7, identity: 0.781
ttacagacc---tcctttaaaccatttttcatttg CRISPR spacer
---aaaaccagatcctttaaacgctttttcatttg Protospacer
*.*** ********** ***********
83. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MG592417 (Vibrio phage 1.033.O._10N.222.49.B8, partial genome) position: , mismatch: 7, identity: 0.781
agtcttccaataacacaaccagactttgccca CRISPR spacer
ttgggtccaataacacaaccagacttcgtcca Protospacer
*********************.*.***
84. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 7, identity: 0.781
agtcttccaataacacaaccagactttgccca CRISPR spacer
ttgggtccaataacacaacctgactttgtcca Protospacer
*************** *******.***
85. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MG592618 (Vibrio phage 1.251.O._10N.261.55.E5, partial genome) position: , mismatch: 7, identity: 0.781
agtcttccaataacacaaccagactttgccca CRISPR spacer
ttgggtccaataacacaacctgactttgtcca Protospacer
*************** *******.***
86. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MG592538 (Vibrio phage 1.171.O._10N.261.52.F12, partial genome) position: , mismatch: 7, identity: 0.781
agtcttccaataacacaaccagactttgccca CRISPR spacer
ttgggtccaataacacaacctgactttgtcca Protospacer
*************** *******.***
87. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 7, identity: 0.781
agtcttccaataacacaaccagactttgccca CRISPR spacer
ttgggtccaataacacaacctgactttgtcca Protospacer
*************** *******.***
88. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.781
agctttctttttgaaaatacctaacatagtga CRISPR spacer
agcagaatttttgaaaataccttatatagtaa Protospacer
*** *************** *.*****.*
89. spacer 1.75|1535296|32|NZ_CP044200|PILER-CR matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 7, identity: 0.781
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcgc Protospacer
*****.*********** ***** * ***
90. spacer 1.75|1535296|32|NZ_CP044200|PILER-CR matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 7, identity: 0.781
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcgc Protospacer
*****.*********** ***** * ***
91. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ttctcggcgcggcgcaatatcccggc-gcacgc CRISPR spacer
ctggcggcgcggggcaatatcgcggcggcatg- Protospacer
.* ******** ******** **** ***.*
92. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ttctcggcgcggcgcaatatcccggc-gcacgc CRISPR spacer
ctggcggcgcggggcaatatcgcggcggcatg- Protospacer
.* ******** ******** **** ***.*
93. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 7, identity: 0.781
ttctcggcgcggcgcaatatcccggc-gcacgc CRISPR spacer
ctggcggcgcggggcaatatcgcggcggcatg- Protospacer
.* ******** ******** **** ***.*
94. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP032704 (Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tcagcgcaatcagcgaaacggtcagctctact--- CRISPR spacer
tcagcgcaatcagcgaataggt---ctccagtgga Protospacer
***************** *** ***.* *
95. spacer 1.93|1536514|33|NZ_CP044200|PILER-CR matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.788
ccgccgattgctgcgccagccacgccaatgacc CRISPR spacer
ccgccgattgttgcgccaggcacggcgaagcgc Protospacer
**********.******** **** *.* * *
96. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.781
-acggcaacggatgcgaccgccagcgcgatccc CRISPR spacer
cgcgccga-ggaagcgaccgccagcgcgagccg Protospacer
.** *.* *** **************** **
97. spacer 2.10|1555101|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 7, identity: 0.781
ttttgtcgaactgataaatacgtggtaaatag CRISPR spacer
atttgtcgaactcagaaatacgtgcataaaag Protospacer
*********** * ********* ** **
98. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021408 (Celeribacter manganoxidans strain DY25 plasmid pDY25-D, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
ccctcggcgatggtgctgggcgacaacatctt Protospacer
**.***********.********. ** * .
99. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
gaggcggcgatggtgctgcgcgacgccctcga Protospacer
* ***********.** ******** **
100. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc- CRISPR spacer
agcgcggcgatggtgttgggtgaagcc-ctgcg Protospacer
. * ****************.** *** .**
101. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc- CRISPR spacer
agcgcggcgatggtgttgggtgaggcc-ctgcg Protospacer
. * ****************.** *** .**
102. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
gaggcggcgatggtgctgcgcgacgccctcga Protospacer
* ***********.** ******** **
103. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
gaggcggcgatggtgctgcgcgacgccctcga Protospacer
* ***********.** ******** **
104. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
ccctcggcgatggtgctgggcgacaacatctt Protospacer
**.***********.********. ** * .
105. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP020386 (Rhodovulum sp. MB263 plasmid pRSMBB, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
tcctcggcgatggtgctgggcgacaacatctt Protospacer
**.***********.********. ** * .
106. spacer 1.16|1535294|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcac Protospacer
*****.*********** ***** * **.
107. spacer 1.16|1535294|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcac Protospacer
*****.*********** ***** * **.
108. spacer 1.17|1535355|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
cccgggcgctgcgcgccgagctgcgcgccgcc Protospacer
*******.******* ******** .**...
109. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
110. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
111. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
112. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
113. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
114. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
caagcacaatcagcgaaaccgtcagcagcaca Protospacer
. ***.************* ****** .**
115. spacer 1.26|1535904|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 8, identity: 0.75
cgatttgattgagttagcctgatccgcgcttt CRISPR spacer
caagcacatcgagttcgcctgatccgcgcttc Protospacer
*.* . **.***** ***************.
116. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010611 (Phaeobacter inhibens strain P92 plasmid pP92_a, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
117. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010675 (Phaeobacter gallaeciensis strain P75 plasmid pP75_b, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
118. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010791 (Phaeobacter gallaeciensis strain P63 plasmid pP63_x_draft, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
119. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010631 (Phaeobacter inhibens strain P78 plasmid pP78_b, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
120. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010716 (Phaeobacter piscinae strain P18 plasmid pP18_a, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
121. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010638 (Phaeobacter gallaeciensis strain P73 plasmid pP73_b, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
122. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP014803 (Salipiger profundus strain JLT2016 plasmid pTPRO7, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
123. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010662 (Phaeobacter inhibens strain P74 plasmid pP74_a, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggt Protospacer
. * *********** ********.****
124. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
gtagcgctggcgcagcgtctgctccagcgtct Protospacer
* ********.******** ****** *
125. spacer 1.32|1536270|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacaataaaaaagtttagcgttttactgta CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgat Protospacer
.* *********.******** ******
126. spacer 1.32|1536270|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacaataaaaaagtttagcgttttactgta CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgat Protospacer
.* *********.******** ******
127. spacer 1.32|1536270|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacaataaaaaagtttagcgttttactgta CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgat Protospacer
.* *********.******** ******
128. spacer 1.32|1536270|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacaataaaaaagtttagcgttttactgta CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgat Protospacer
.* *********.******** ******
129. spacer 1.32|1536270|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacaataaaaaagtttagcgttttactgta CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgat Protospacer
.* *********.******** ******
130. spacer 1.33|1536331|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 8, identity: 0.75
-----aattccccgtcggcacacagtgcggccaccag CRISPR spacer
accagaat-----gtctgcacacagtgcgaccaccac Protospacer
*** *** ************.******
131. spacer 1.34|1536392|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_003905 (Proteus vulgaris plasmid Rts1 DNA, complete sequence) position: , mismatch: 8, identity: 0.75
----acgttgattgcaggcgctccattttctctttg CRISPR spacer
ggaagcgttga----aggcgctcaattttctcttct Protospacer
.****** ******** **********.
132. spacer 1.35|1536453|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ataactgt-ccgaattcaatcggttcaagctgt CRISPR spacer
-cgatcgtgccggattcaatcggctcaagctga Protospacer
..*..** ***.**********.********
133. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
134. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
135. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
136. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
137. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
138. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
139. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
140. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
141. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
142. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
143. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
144. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
145. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
146. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
147. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
148. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
149. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
150. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 8, identity: 0.75
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
gccccgattgctgcgccagcgaggccgccgag Protospacer
* ***************** * ***. .**
151. spacer 1.37|1536575|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
gttgcggccagccttgcggatcagctcatggg CRISPR spacer
cgtgcggccggccttgcggaacagcggctggc Protospacer
*******.********** **** ***
152. spacer 1.37|1536575|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.75
gttgcggccagccttgcggatcagctcatggg CRISPR spacer
cgtgcggcccgccttgcggaacagcggctggc Protospacer
******* ********** **** ***
153. spacer 1.40|1536758|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP035565 (Lactobacillus paracasei strain SRCM103299 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
ggcagcaactggaacgggttagccccgtacgc CRISPR spacer
cggaacacctggaacgggttggccccgtccat Protospacer
* *.** ************.******* *..
154. spacer 1.40|1536758|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP018394 (Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-2) position: , mismatch: 8, identity: 0.75
ggcagcaactggaacgggttagccccgtacgc CRISPR spacer
cggaacacctggaacgggttggccccgtccat Protospacer
* *.** ************.******* *..
155. spacer 1.40|1536758|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP018394 (Lactobacillus paracasei strain IJH-SONE68 plasmid pLPS-2) position: , mismatch: 8, identity: 0.75
ggcagcaactggaacgggttagccccgtacgc CRISPR spacer
cggaacacctggaacgggttggccccgtccat Protospacer
* *.** ************.******* *..
156. spacer 1.40|1536758|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039708 (Lactobacillus paracasei strain Lp02 plasmid pLp02-1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagcaactggaacgggttagccccgtacgc CRISPR spacer
cggaacacctggaacgggttggccccgtccat Protospacer
* *.** ************.******* *..
157. spacer 1.40|1536758|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP014987 (Lactobacillus paracasei strain IIA plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagcaactggaacgggttagccccgtacgc CRISPR spacer
cggaacacctggaacgggttggccccgtccat Protospacer
* *.** ************.******* *..
158. spacer 1.42|1536880|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP030069 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.4, complete sequence) position: , mismatch: 8, identity: 0.75
-----ttacagacctcctttaaaccatttttcatttg CRISPR spacer
ttcgctta-----cttctttataccatttttcatttt Protospacer
*** **.***** **************
159. spacer 1.42|1536880|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 8, identity: 0.75
ttacagacctcctttaaaccatttttcatttg CRISPR spacer
acagaaacctccattaaaccattttttatatc Protospacer
.* *.****** *************.** *
160. spacer 1.45|1537063|32|NZ_CP044200|CRISPRCasFinder,CRT matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 8, identity: 0.75
aattccccgtttggatattgaggattccactc CRISPR spacer
ggctacccgtttggatattgatgattccgatt Protospacer
...* **************** ******. *.
161. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013508 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G2, isolate: uvMED-CGR-C15J-MedDCM-OCT-S37-C55) position: , mismatch: 8, identity: 0.75
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
cgtaagatgagagaaggcatgagtttcactga Protospacer
*. *******.************* ** *
162. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013868 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S36-C128, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
cgtaagatgagagaaggcatgagtttcactga Protospacer
*. *******.************* ** *
163. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013867 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S34-C62, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
cgtaagatgagagaaggcatgagtttcactga Protospacer
*. *******.************* ** *
164. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013875 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S45-C106, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
cgtaagatgagagaaggcatgagtttcactga Protospacer
*. *******.************* ** *
165. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013870 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S38-C53, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
cgtaagatgagagaaggcatgagtttcactga Protospacer
*. *******.************* ** *
166. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013865 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S32-C115, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
cgtaagatgagagaaggcatgagtttcactga Protospacer
*. *******.************* ** *
167. spacer 1.56|1537734|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MG770228 (Escherichia phage PMBT57, complete genome) position: , mismatch: 8, identity: 0.75
tattgattactgaataaagtcgattgcgacta CRISPR spacer
tattgcttactgaataaagtagaggacatata Protospacer
***** ************** ** .*. **
168. spacer 1.56|1537734|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MK931297 (Escherichia phage vB_EcoP_3HA13, complete genome) position: , mismatch: 8, identity: 0.75
tattgattactgaataaagtcgattgcgacta CRISPR spacer
tattgcttactgaataaagtagaggacatata Protospacer
***** ************** ** .*. **
169. spacer 1.56|1537734|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_008720 (Enterobacteria phage N4, complete genome) position: , mismatch: 8, identity: 0.75
tattgattactgaataaagtcgattgcgacta CRISPR spacer
tattgcttactgaataaagtagaagacatata Protospacer
***** ************** ** .*. **
170. spacer 1.56|1537734|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MH992123 (UNVERIFIED: Escherichia phage OLB145, complete genome) position: , mismatch: 8, identity: 0.75
tattgattactgaataaagtcgattgcgacta CRISPR spacer
tattgcttactgaataaagtagaagacatata Protospacer
***** ************** ** .*. **
171. spacer 1.57|1537795|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_016746 (Oceanimonas sp. GK1 plasmid pOCEGK01, complete sequence) position: , mismatch: 8, identity: 0.75
ccggtagtgagcaaactgctctctttcttgcg CRISPR spacer
cgggtcgttagcaaactgctctcttttgggtt Protospacer
* *** ** *****************. *.
172. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP021408 (Celeribacter manganoxidans strain DY25 plasmid pDY25-D, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
ccctcggcgatggtgctgggcgacaacatctt Protospacer
**.***********.********. ** * .
173. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
gaggcggcgatggtgctgcgcgacgccctcga Protospacer
* ***********.** ******** **
174. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc- CRISPR spacer
agcgcggcgatggtgttgggtgaagcc-ctgcg Protospacer
. * ****************.** *** .**
175. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc- CRISPR spacer
agcgcggcgatggtgttgggtgaggcc-ctgcg Protospacer
. * ****************.** *** .**
176. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
gaggcggcgatggtgctgcgcgacgccctcga Protospacer
* ***********.** ******** **
177. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
gaggcggcgatggtgctgcgcgacgccctcga Protospacer
* ***********.** ******** **
178. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
ccctcggcgatggtgctgggcgacaacatctt Protospacer
**.***********.********. ** * .
179. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP020386 (Rhodovulum sp. MB263 plasmid pRSMBB, complete sequence) position: , mismatch: 8, identity: 0.75
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
tcctcggcgatggtgctgggcgacaacatctt Protospacer
**.***********.********. ** * .
180. spacer 1.75|1535296|32|NZ_CP044200|PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcac Protospacer
*****.*********** ***** * **.
181. spacer 1.75|1535296|32|NZ_CP044200|PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acttttgatccatgcgattacggatttctgcg- CRISPR spacer
cgttttggtccatgcgatttcggatgac-gcac Protospacer
*****.*********** ***** * **.
182. spacer 1.76|1535357|32|NZ_CP044200|PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
accgggcgttgcgcgcagagctgcggaccatt CRISPR spacer
cccgggcgctgcgcgccgagctgcgcgccgcc Protospacer
*******.******* ******** .**...
183. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
184. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
185. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
186. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
187. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
tcatcgtaatcagcgaaacggtcagaagaagg Protospacer
*** **.****************** *
188. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
caagcacaatcagcgaaaccgtcagcagcaca Protospacer
. ***.************* ****** .**
189. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75
acggcaacggatgcgaccgccagcgcgatccc CRISPR spacer
cgggccgaggatgcgaccgcgagcgcgagccg Protospacer
*** . ************ ******* **
190. spacer 2.1|1554552|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.75
acggcaac-----ggatgcgaccgccagcgcgatccc CRISPR spacer
-----aacttcctcgaagcgaccgccaccgcgatccc Protospacer
*** ** ********** *********
191. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_015845 (Enterococcus hirae ATCC 9790 plasmid pTG9790, complete sequence) position: , mismatch: 8, identity: 0.75
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
tcactatacaaaaagaataattttcatattct Protospacer
* *.****** ****************.
192. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.75
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
accaactgcaataatattaattttcatatttt Protospacer
**..***** **** *************..
193. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT773554 (Myoviridae sp. isolate BML_2 genomic sequence) position: , mismatch: 8, identity: 0.75
-tgcagttgcaaaaataataattttcatattcc CRISPR spacer
atgta-ttgcaaaaataataaaattcatagatt Protospacer
**.* *************** ****** ..
194. spacer 2.7|1554918|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022209 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atggggcgtgtgcatcgctcgcatttctgcat CRISPR spacer
ctggggggtgtgcaacgctcgcattctcgccg Protospacer
***** ******* **********...**
195. spacer 2.7|1554918|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009321 (Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
atggggcgtgtgcatcgctcgcatttctgcat CRISPR spacer
ctggggggtgtgcaacgctcgcattctcgccg Protospacer
***** ******* **********...**
196. spacer 2.7|1554918|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022007 (Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence) position: , mismatch: 8, identity: 0.75
atggggcgtgtgcatcgctcgcatttctgcat CRISPR spacer
ctggggggtgtgcaacgctcgcattctcgccg Protospacer
***** ******* **********...**
197. spacer 2.8|1554979|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022209 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atggggcgtgtgcatcgctcgcatttctgcat CRISPR spacer
ctggggggtgtgcaacgctcgcattctcgccg Protospacer
***** ******* **********...**
198. spacer 2.8|1554979|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009321 (Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
atggggcgtgtgcatcgctcgcatttctgcat CRISPR spacer
ctggggggtgtgcaacgctcgcattctcgccg Protospacer
***** ******* **********...**
199. spacer 2.8|1554979|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022007 (Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence) position: , mismatch: 8, identity: 0.75
atggggcgtgtgcatcgctcgcatttctgcat CRISPR spacer
ctggggggtgtgcaacgctcgcattctcgccg Protospacer
***** ******* **********...**
200. spacer 2.10|1555101|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MN693196 (Marine virus AFVG_25M118, complete genome) position: , mismatch: 8, identity: 0.75
ttttgtcgaactgataaatacgtggtaaatag CRISPR spacer
tcttgtcgaactgataaataagtggcgcgccg Protospacer
*.****************** ****.. .. *
201. spacer 2.14|1555345|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 8, identity: 0.75
acaaatcaaaatataatcgttctgaacattct CRISPR spacer
acttacaaaaatataatccttctgaaaattac Protospacer
** *. *********** ******* *** .
202. spacer 2.14|1555345|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 8, identity: 0.75
acaaatcaaaatataatcgttctgaacattct CRISPR spacer
acttacaaaaatataatccttctgaaaattac Protospacer
** *. *********** ******* *** .
203. spacer 2.14|1555345|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 8, identity: 0.75
acaaatcaaaatataatcgttctgaacattct CRISPR spacer
acttacaaaaatataatccttctgaaaattac Protospacer
** *. *********** ******* *** .
204. spacer 2.14|1555345|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 8, identity: 0.75
acaaatcaaaatataatcgttctgaacattct CRISPR spacer
acttacaaaaatataatccttctgaaaattac Protospacer
** *. *********** ******* *** .
205. spacer 2.14|1555345|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 8, identity: 0.75
acaaatcaaaatataatcgttctgaacattct CRISPR spacer
acttacaaaaatataatccttctgaaaattac Protospacer
** *. *********** ******* *** .
206. spacer 2.14|1555345|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.75
acaaatcaaaatataatcgttctgaacattct CRISPR spacer
acttacaaaaatataatccttctgaaaattac Protospacer
** *. *********** ******* *** .
207. spacer 1.8|1534806|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 9, identity: 0.719
cccaactgaaaaaggagattcagtcaggtcgc CRISPR spacer
agcaactgaaaaaggcgatacagtcagccatt Protospacer
************* *** ******* . .
208. spacer 1.10|1534928|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 9, identity: 0.719
tccagcccacaccaaaaattcagccaaacctc CRISPR spacer
gccagcccacaccaaaacatcagcgatgggtg Protospacer
**************** ***** * . *
209. spacer 1.10|1534928|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP026416 (Acinetobacter sp. ACNIH2 plasmid pACI-3569, complete sequence) position: , mismatch: 9, identity: 0.719
--tccagcccacaccaaaaattcagccaaacctc CRISPR spacer
atactgg--cagaccaaaaatccagccaaacccg Protospacer
*..* ** *********.**********.
210. spacer 1.10|1534928|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719
tccagcccacaccaaaaattcagccaaacctc CRISPR spacer
ccgagcctacatcaaaaattcagccatgtccg Protospacer
.* ****.***.************** ..*.
211. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
212. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
213. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
214. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
215. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
216. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
217. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
218. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
219. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
220. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
221. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
222. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
223. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
224. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
225. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
226. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
227. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
228. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
229. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
230. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
231. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgatggtgttggccgtcgccgcatc Protospacer
. * *************** ** ****. *
232. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
233. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
234. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
235. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
236. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
237. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
238. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
239. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
240. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
241. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
242. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
243. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
244. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
245. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
246. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
247. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
248. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
249. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
250. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
251. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
252. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
253. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
254. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
255. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
256. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
257. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
258. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
259. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
260. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
261. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
262. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
263. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
264. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
265. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
266. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
267. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
268. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
269. spacer 1.15|1535233|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
270. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcgttcacgctgcgcaatatcccggcgcgcga Protospacer
. *. .*** *****************.**
271. spacer 1.21|1535599|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP040718 (Aeromonas veronii strain HX3 plasmid pHX3, complete sequence) position: , mismatch: 9, identity: 0.719
ccgttggtcaggcaggtatggcggcgcaaaac CRISPR spacer
atgtaggtcatgcaggtatggcggctaatgcc Protospacer
.** ***** ************** * . *
272. spacer 1.21|1535599|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP013966 (Aeromonas hydrophila strain D4 plasmid pAhD4-1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgttggtcaggcaggtatggcggcgcaaaac CRISPR spacer
atgtaggtcatgcaggtatggcggctaatgcc Protospacer
.** ***** ************** * . *
273. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 9, identity: 0.719
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgcaatcagcgcaccggtcacatacagc Protospacer
.************** * ****** * .* .
274. spacer 1.24|1535782|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP020717 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tgcgcaatgtccccgggcgggtggtgtcgctg CRISPR spacer
ccgagattttccccgggccggcggtgtcgctg Protospacer
. . * * ********* **.**********
275. spacer 1.29|1536087|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN694369 (Marine virus AFVG_250M682, complete genome) position: , mismatch: 9, identity: 0.719
gctgtcgttattagctgcaataaaaacgaaac CRISPR spacer
attaaaattatttgctgcaataaaaaagaaag Protospacer
..*. .***** ************* ****
276. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
catcatctggcgcggcgtatgcaccaccggaa Protospacer
.. *. ************ ******* *** .
277. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
atcctgaaggcgctgcgtctgcaccagtggct Protospacer
* * ***** *************.***
278. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
cggtttttgccgcggcgtctgcaccggcggtg Protospacer
.*.. .** ***************.****.*
279. spacer 1.32|1536270|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_021794 (Cellulophaga phage phi18:3, complete genome) position: , mismatch: 9, identity: 0.719
gcgacaataaaaaagtttagcgttttactgta CRISPR spacer
accagtgtaaataagtttagcgtttttctgcc Protospacer
.* * .**** ************** ***.
280. spacer 1.35|1536453|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
ataactgtccgaattcaatcggttcaagctgt CRISPR spacer
gtacgcgtccgatttccatcggttcaagcacg Protospacer
.** .****** *** ************
281. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_016907 (Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence) position: , mismatch: 9, identity: 0.719
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
tgcgtaactgctgcggcagcgacgccaatgac Protospacer
. ..*.******* **** ***********
282. spacer 1.37|1536575|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT708549 (Burkholderia phage Maja, complete genome) position: , mismatch: 9, identity: 0.719
gttgcggccagccttgcggatcagctcatggg CRISPR spacer
tacgcggccatccttgcggagcagcttcaggc Protospacer
.******* ********* *****. **
283. spacer 1.38|1536636|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_006578 ([Bacillus thuringiensis] serovar konkukian str. 97-27 plasmid pBT9727, complete sequence) position: , mismatch: 9, identity: 0.719
acattccccttttgaatcaatgttaaatcgcg CRISPR spacer
tgaatccccttttgaatcaatgatatatattc Protospacer
* ****************** ** ** .
284. spacer 1.38|1536636|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP053937 (Bacillus thuringiensis strain FDAARGOS_792 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acattccccttttgaatcaatgttaaatcgcg CRISPR spacer
tgaatccccttttgaatcaatgatatatattc Protospacer
* ****************** ** ** .
285. spacer 1.38|1536636|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP053978 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acattccccttttgaatcaatgttaaatcgcg CRISPR spacer
tgaatccccttttgaatcaatgatatatattc Protospacer
* ****************** ** ** .
286. spacer 1.38|1536636|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010087 (Bacillus thuringiensis strain 97-27 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acattccccttttgaatcaatgttaaatcgcg CRISPR spacer
tgaatccccttttgaatcaatgatatatattc Protospacer
* ****************** ** ** .
287. spacer 1.38|1536636|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP009333 (Bacillus thuringiensis strain HD1011 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
acattccccttttgaatcaatgttaaatcgcg CRISPR spacer
tgaatccccttttgaatcaatgatatatattc Protospacer
* ****************** ** ** .
288. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
ggcccgatgatggaaggcatgagcgaaatgag Protospacer
**** ***** ************. * * . .
289. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_010157 (Yersinia pestis Angola plasmid new_pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
290. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_005813 (Yersinia pestis biovar Microtus str. 91001 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
291. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009491 (Yersinia pestis strain PBM19 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
292. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009713 (Yersinia pestis Pestoides F plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
293. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009703 (Yersinia pestis strain Harbin35 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
294. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009783 (Yersinia pestis strain El Dorado plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
295. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009721 (Yersinia pestis strain Shasta plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
296. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045260 (Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
297. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033695 (Yersinia pestis strain FDAARGOS_602 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
298. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_009377 (Yersinia pestis Pestoides F plasmid CD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
299. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_014017 (Yersinia pestis Z176003 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
300. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_017263 (Yersinia pestis biovar Medievalis str. Harbin 35 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
301. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033697 (Yersinia pestis strain FDAARGOS_601 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
302. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045147 (Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
303. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045156 (Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
304. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045160 (Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
305. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006747 (Yersinia pestis 8787 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
306. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009972 (Yersinia pestis CO92 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
307. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_003131 (Yersinia pestis CO92 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
308. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045151 (Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
309. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006791 (Yersinia pestis 2944 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
310. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006750 (Yersinia pestis 3770 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
311. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006757 (Yersinia pestis 1522 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
312. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_017157 (Yersinia pestis D182038 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
313. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_017153 (Yersinia pestis D106004 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
314. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_004839 (Yersinia pestis strain KIM5 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
315. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033689 (Yersinia pestis strain FDAARGOS_603 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
316. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006761 (Yersinia pestis 1413 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
317. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006780 (Yersinia pestis 1412 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
318. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006753 (Yersinia pestis 3067 plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
319. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016274 (Yersinia pestis strain Cadman plasmid pCD1, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
320. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009905 (Yersinia pestis Antiqua plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
321. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009990 (Yersinia pestis strain Nicholisk 41 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
322. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009937 (Yersinia pestis Angola plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
323. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009842 (Yersinia pestis strain Dodson plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
324. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010246 (Yersinia pestis Pestoides G plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
325. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010022 (Yersinia pestis str. Pestoides B plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
326. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_015056 (Yersinia pestis Java 9 plasmid pCD, complete sequence) position: , mismatch: 9, identity: 0.719
agctttctttttgaaaatacctaacatagtga CRISPR spacer
tattttcttattaaaaatacctaacacaaaaa Protospacer
..****** **.*************.*. .*
327. spacer 1.67|1534808|32|NZ_CP044200|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 9, identity: 0.719
cccaactgaaaaaggagattcagtcaggtcgc CRISPR spacer
agcaactgaaaaaggcgatacagtcagccatt Protospacer
************* *** ******* . .
328. spacer 1.69|1534930|32|NZ_CP044200|PILER-CR matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 9, identity: 0.719
tccagcccacaccaaaaattcagccaaacctc CRISPR spacer
gccagcccacaccaaaacatcagcgatgggtg Protospacer
**************** ***** * . *
329. spacer 1.69|1534930|32|NZ_CP044200|PILER-CR matches to NZ_CP026416 (Acinetobacter sp. ACNIH2 plasmid pACI-3569, complete sequence) position: , mismatch: 9, identity: 0.719
--tccagcccacaccaaaaattcagccaaacctc CRISPR spacer
atactgg--cagaccaaaaatccagccaaacccg Protospacer
*..* ** *********.**********.
330. spacer 1.69|1534930|32|NZ_CP044200|PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719
tccagcccacaccaaaaattcagccaaacctc CRISPR spacer
ccgagcctacatcaaaaattcagccatgtccg Protospacer
.* ****.***.************** ..*.
331. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
332. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
333. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
334. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
335. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
336. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
337. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
338. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
339. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
340. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
341. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
342. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
343. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
344. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
345. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
346. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
347. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
348. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
349. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
350. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
351. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgatggtgttggccgtcgccgcatc Protospacer
. * *************** ** ****. *
352. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
353. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
354. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
355. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
356. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
357. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
358. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
359. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
360. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
361. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
362. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
363. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
364. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
365. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
366. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
367. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
368. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
369. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
370. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
371. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
372. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
373. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
374. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
375. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
376. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
377. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
378. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
379. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
380. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
381. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
382. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
383. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
384. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
385. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
386. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
387. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
388. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
389. spacer 1.74|1535235|32|NZ_CP044200|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gccccggcgatggtgttgggcgacgccaacgc CRISPR spacer
agcacggcgttggtgctgggcgacgcctgcag Protospacer
. * ***** *****.*********** .*.
390. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
gcgttcacgctgcgcaatatcccggcgcgcga Protospacer
. *. .*** *****************.**
391. spacer 1.80|1535601|32|NZ_CP044200|PILER-CR matches to NZ_CP040718 (Aeromonas veronii strain HX3 plasmid pHX3, complete sequence) position: , mismatch: 9, identity: 0.719
ccgttggtcaggcaggtatggcggcgcaaaac CRISPR spacer
atgtaggtcatgcaggtatggcggctaatgcc Protospacer
.** ***** ************** * . *
392. spacer 1.80|1535601|32|NZ_CP044200|PILER-CR matches to NZ_CP013966 (Aeromonas hydrophila strain D4 plasmid pAhD4-1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgttggtcaggcaggtatggcggcgcaaaac CRISPR spacer
atgtaggtcatgcaggtatggcggctaatgcc Protospacer
.** ***** ************** * . *
393. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 9, identity: 0.719
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgcaatcagcgcaccggtcacatacagc Protospacer
.************** * ****** * .* .
394. spacer 1.83|1535904|33|NZ_CP044200|PILER-CR matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 9, identity: 0.727
cgatttgattgagttagcctgatccgcgctttc CRISPR spacer
caagcacatcgagttcgcctgatccgcgcttct Protospacer
*.* . **.***** ***************..
395. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010611 (Phaeobacter inhibens strain P92 plasmid pP92_a, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
396. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010675 (Phaeobacter gallaeciensis strain P75 plasmid pP75_b, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
397. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010791 (Phaeobacter gallaeciensis strain P63 plasmid pP63_x_draft, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
398. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010631 (Phaeobacter inhibens strain P78 plasmid pP78_b, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
399. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010716 (Phaeobacter piscinae strain P18 plasmid pP18_a, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
400. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010638 (Phaeobacter gallaeciensis strain P73 plasmid pP73_b, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
401. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP014803 (Salipiger profundus strain JLT2016 plasmid pTPRO7, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
402. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP010662 (Phaeobacter inhibens strain P74 plasmid pP74_a, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gatctgctggcgcggcttctgcaccggcgggtt Protospacer
. * *********** ********.**** .
403. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
gtagcgctggcgcagcgtctgctccagcgtctg Protospacer
* ********.******** ****** *
404. spacer 1.88|1536209|33|NZ_CP044200|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
tgacggctggcgcggcgtctgcaccagcggcgc CRISPR spacer
catcatctggcgcggcgtatgcaccaccggaac Protospacer
.. *. ************ ******* *** .*
405. spacer 1.89|1536270|33|NZ_CP044200|PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgacaataaaaaagtttagcgttttactgtac CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgatt Protospacer
.* *********.******** ****** .
406. spacer 1.89|1536270|33|NZ_CP044200|PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgacaataaaaaagtttagcgttttactgtac CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgatt Protospacer
.* *********.******** ****** .
407. spacer 1.89|1536270|33|NZ_CP044200|PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 9, identity: 0.727
gcgacaataaaaaagtttagcgttttactgtac CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgatt Protospacer
.* *********.******** ****** .
408. spacer 1.89|1536270|33|NZ_CP044200|PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 9, identity: 0.727
gcgacaataaaaaagtttagcgttttactgtac CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgatt Protospacer
.* *********.******** ****** .
409. spacer 1.89|1536270|33|NZ_CP044200|PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgacaataaaaaagtttagcgttttactgtac CRISPR spacer
caaaaaataaaaaaatttagcgtgttactgatt Protospacer
.* *********.******** ****** .
410. spacer 1.95|1536636|33|NZ_CP044200|PILER-CR matches to NC_006578 ([Bacillus thuringiensis] serovar konkukian str. 97-27 plasmid pBT9727, complete sequence) position: , mismatch: 9, identity: 0.727
acattccccttttgaatcaatgttaaatcgcgc CRISPR spacer
tgaatccccttttgaatcaatgatatatattcc Protospacer
* ****************** ** ** . *
411. spacer 1.95|1536636|33|NZ_CP044200|PILER-CR matches to NZ_CP053978 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
acattccccttttgaatcaatgttaaatcgcgc CRISPR spacer
tgaatccccttttgaatcaatgatatatattcc Protospacer
* ****************** ** ** . *
412. spacer 1.95|1536636|33|NZ_CP044200|PILER-CR matches to NZ_CP009333 (Bacillus thuringiensis strain HD1011 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.727
acattccccttttgaatcaatgttaaatcgcgc CRISPR spacer
tgaatccccttttgaatcaatgatatatattcc Protospacer
* ****************** ** ** . *
413. spacer 1.95|1536636|33|NZ_CP044200|PILER-CR matches to NZ_CP053937 (Bacillus thuringiensis strain FDAARGOS_792 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acattccccttttgaatcaatgttaaatcgcgc CRISPR spacer
tgaatccccttttgaatcaatgatatatattcc Protospacer
* ****************** ** ** . *
414. spacer 1.95|1536636|33|NZ_CP044200|PILER-CR matches to NZ_CP010087 (Bacillus thuringiensis strain 97-27 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
acattccccttttgaatcaatgttaaatcgcgc CRISPR spacer
tgaatccccttttgaatcaatgatatatattcc Protospacer
* ****************** ** ** . *
415. spacer 1.104|1537185|33|NZ_CP044200|PILER-CR matches to AP013867 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S34-C62, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727
ggccagatgagggaaggcatgagttacagacaa CRISPR spacer
cgtaagatgagagaaggcatgagtttcactgat Protospacer
*. *******.************* ** *
416. spacer 1.104|1537185|33|NZ_CP044200|PILER-CR matches to AP013870 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S38-C53, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727
ggccagatgagggaaggcatgagttacagacaa CRISPR spacer
cgtaagatgagagaaggcatgagtttcactgat Protospacer
*. *******.************* ** *
417. spacer 1.104|1537185|33|NZ_CP044200|PILER-CR matches to AP013508 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G2, isolate: uvMED-CGR-C15J-MedDCM-OCT-S37-C55) position: , mismatch: 9, identity: 0.727
ggccagatgagggaaggcatgagttacagacaa CRISPR spacer
cgtaagatgagagaaggcatgagtttcactgat Protospacer
*. *******.************* ** *
418. spacer 1.104|1537185|33|NZ_CP044200|PILER-CR matches to AP013868 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S36-C128, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727
ggccagatgagggaaggcatgagttacagacaa CRISPR spacer
cgtaagatgagagaaggcatgagtttcactgat Protospacer
*. *******.************* ** *
419. spacer 1.104|1537185|33|NZ_CP044200|PILER-CR matches to AP013875 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S45-C106, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727
ggccagatgagggaaggcatgagttacagacaa CRISPR spacer
cgtaagatgagagaaggcatgagtttcactgat Protospacer
*. *******.************* ** *
420. spacer 1.104|1537185|33|NZ_CP044200|PILER-CR matches to AP013865 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S32-C115, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727
ggccagatgagggaaggcatgagttacagacaa CRISPR spacer
cgtaagatgagagaaggcatgagtttcactgat Protospacer
*. *******.************* ** *
421. spacer 2.2|1554613|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 9, identity: 0.719
ttcagaggctcgataccaggatgggatcgggc CRISPR spacer
cacggcggctcgataccaggaccggatcgcca Protospacer
. *.* ***************. ******
422. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to AP013437 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C100-MedDCM-OCT-S33-C20) position: , mismatch: 9, identity: 0.719
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
gcttgttgcataaataataattttcttaaatc Protospacer
. ****** ************** ** .*
423. spacer 2.6|1554857|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
taataaccggcgttcgcagctatctgcggaaa CRISPR spacer
tgcgcttcggcgttcgcggctatctgctgaac Protospacer
*. .**********.********* ***
424. spacer 2.7|1554918|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
atggggcgtgtgcatcgctcgcatttctgcat- CRISPR spacer
cgtcggcatgttcatcgctcgcatttcc-cgtg Protospacer
***.*** ***************. *.*
425. spacer 2.8|1554979|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
atggggcgtgtgcatcgctcgcatttctgcat- CRISPR spacer
cgtcggcatgttcatcgctcgcatttcc-cgtg Protospacer
***.*** ***************. *.*
426. spacer 2.9|1555040|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtagcgctcggcgaggcggtgattcccctc CRISPR spacer
atgcccaggtcggcgaggcggtgcttctcctc Protospacer
..*. * ************** ***.****
427. spacer 2.9|1555040|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtagcgctcggcgaggcggtgattcccctc CRISPR spacer
gcgtagccctcggcgtggcggtgctgtagaac Protospacer
******* ******* ******* * . *
428. spacer 2.13|1555284|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.719
gacagcaccgtttctaagcctatcgccatttc CRISPR spacer
acgaccaccgtttcgaagcccatcgccacggc Protospacer
. * ********* *****.*******. *
429. spacer 1.6|1534684|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 10, identity: 0.688
gaccatcatttcccctgccagcgcgcgcgatt CRISPR spacer
cggcatcattccccctgccggcgcgccgcagc Protospacer
. *******.********.****** * .
430. spacer 1.7|1534745|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP012644 (Rufibacter tibetensis strain 1351 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
ttagaagctgaaagatgggcagggaaaaagac CRISPR spacer
gggtaagctggaagatgggcaggtaaaggtag Protospacer
. ******.************ ***.. *
431. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 10, identity: 0.688
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
cggcatgcgcggcgcaatatcctggggcaccg Protospacer
. . ****************.** ****
432. spacer 1.18|1535416|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010644 (Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence) position: , mismatch: 10, identity: 0.688
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
cggcgtgcgcggcgcaatatcctggggcaccg Protospacer
. . ****************.** ****
433. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP010872 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
434. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045411 (Roseovarius sp. THAF8 plasmid pTHAF8_a, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
435. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
436. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045394 (Roseovarius sp. THAF27 plasmid pTHAF27_a, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
437. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045405 (Roseovarius sp. THAF9 plasmid pTHAF9_a, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
438. spacer 1.22|1535660|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP018078 (Sulfitobacter sp. AM1-D1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
439. spacer 1.23|1535721|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
attgagcgtcgagcactcgccaggcgacagct CRISPR spacer
cccagacatcgagcacgcgccagccgacagcg Protospacer
.....*.******** ****** *******
440. spacer 1.28|1536026|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP038449 (Aeromonas media strain R50-22 plasmid pAeme5, complete sequence) position: , mismatch: 10, identity: 0.688
aagtaaccgcgccatcatgcgggcgctttttt CRISPR spacer
ctcggcccgcgccatcatccgggcgctgttgc Protospacer
. ************ ******** ** .
441. spacer 1.28|1536026|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP038446 (Aeromonas media strain R25-3 plasmid pAeme3, complete sequence) position: , mismatch: 10, identity: 0.688
aagtaaccgcgccatcatgcgggcgctttttt CRISPR spacer
ctcggcccgcgccatcatccgggcgctgttgc Protospacer
. ************ ******** ** .
442. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN694771 (Marine virus AFVG_250M352, complete genome) position: , mismatch: 10, identity: 0.688
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
cacaggctgacgcagcgtctgcaccagaacca Protospacer
.. *****.***.************* . *.
443. spacer 1.31|1536209|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN693785 (Marine virus AFVG_250M536, complete genome) position: , mismatch: 10, identity: 0.688
tgacggctggcgcggcgtctgcaccagcggcg CRISPR spacer
cacaggctgacgcagcgtctgcaccagaacca Protospacer
.. *****.***.************* . *.
444. spacer 1.36|1536514|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 10, identity: 0.688
ccgccgattgctgcgccagccacgccaatgac CRISPR spacer
tcgccgattccggcgccagccacgatgcgcag Protospacer
.******** * ************ .. *
445. spacer 1.43|1536941|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ccctgactgacgctatcaaaaaggcgctctcc CRISPR spacer
cggtggctgacgctatcataaaggcgtggcag Protospacer
* **.************ *******. .
446. spacer 1.43|1536941|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 10, identity: 0.688
ccctgactgacgctatcaaaaaggcgctctcc CRISPR spacer
cggtggctgacgctatcataaaggcgtggcag Protospacer
* **.************ *******. .
447. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT498051 (Microbacterium phage Jahseh, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
448. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MH744416 (Microbacterium phage Dongwon, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
449. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT498038 (Microbacterium phage Luxx, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
450. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MH651181 (Microbacterium phage Minima, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
451. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MK801730 (Microbacterium phage Belthelas, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
452. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MN284892 (Microbacterium phage Bradley2, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
453. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT521990 (Microbacterium phage Bri160, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
454. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MH779512 (Microbacterium phage Miaurora, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
455. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT498047 (Microbacterium phage TinyTruffula, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
456. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT310864 (Microbacterium phage Nobel, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
457. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MH045561 (Microbacterium phage PaoPu, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
458. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT498065 (Microbacterium phage PoRanda, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
459. spacer 1.44|1537002|32|NZ_CP044200|CRISPRCasFinder,CRT matches to MT639642 (Microbacterium phage YertPhresh, complete genome) position: , mismatch: 10, identity: 0.688
cggattgtcggcagcagaacctcccacgcctc CRISPR spacer
ccaggctcgggctgcagatcctcccacgcctc Protospacer
* .. . . *** ***** *************
460. spacer 1.47|1537185|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 10, identity: 0.688
ggccagatgagggaaggcatgagttacagaca CRISPR spacer
ttccggatgagggaagacatgagttcgccgcg Protospacer
**.***********.******** .*.
461. spacer 1.58|1537856|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MH319764 (Marine virus AG-345-P14 Ga0172274_11 genomic sequence) position: , mismatch: 10, identity: 0.688
agtcttccaataacacaaccagactttgccca CRISPR spacer
atagatccattaacacaacaagactttgaaat Protospacer
* **** ********* ********
462. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NC_041887 (Rhodococcus phage Weasels2, complete genome) position: , mismatch: 10, identity: 0.688
agctttctttttgaaaatacctaacatagtga CRISPR spacer
aagaatctttttgaagattcctaacataacct Protospacer
*. **********.** *********..
463. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MH153812 (Rhodococcus phage Grayson, complete genome) position: , mismatch: 10, identity: 0.688
agctttctttttgaaaatacctaacatagtga CRISPR spacer
aagaatcttcttgaagatacctaacataactt Protospacer
*. ****.*****.************..
464. spacer 1.65|1534686|32|NZ_CP044200|PILER-CR matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 10, identity: 0.688
gaccatcatttcccctgccagcgcgcgcgatt CRISPR spacer
cggcatcattccccctgccggcgcgccgcagc Protospacer
. *******.********.****** * .
465. spacer 1.66|1534747|32|NZ_CP044200|PILER-CR matches to NZ_CP012644 (Rufibacter tibetensis strain 1351 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
ttagaagctgaaagatgggcagggaaaaagac CRISPR spacer
gggtaagctggaagatgggcaggtaaaggtag Protospacer
. ******.************ ***.. *
466. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 10, identity: 0.688
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
cggcatgcgcggcgcaatatcctggggcaccg Protospacer
. . ****************.** ****
467. spacer 1.77|1535418|32|NZ_CP044200|PILER-CR matches to NZ_CP010644 (Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence) position: , mismatch: 10, identity: 0.688
ttctcggcgcggcgcaatatcccggcgcacgc CRISPR spacer
cggcgtgcgcggcgcaatatcctggggcaccg Protospacer
. . ****************.** ****
468. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP010872 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
469. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP045411 (Roseovarius sp. THAF8 plasmid pTHAF8_a, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
470. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
471. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP045394 (Roseovarius sp. THAF27 plasmid pTHAF27_a, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
472. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP045405 (Roseovarius sp. THAF9 plasmid pTHAF9_a, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
473. spacer 1.81|1535662|32|NZ_CP044200|PILER-CR matches to NZ_CP018078 (Sulfitobacter sp. AM1-D1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tcagcgcaatcagcgaaacggtcagctctact CRISPR spacer
ccagcgccatgagcgaaacggtcaatcgttgc Protospacer
.****** ** *************... * .
474. spacer 1.86|1536087|33|NZ_CP044200|PILER-CR matches to MN694369 (Marine virus AFVG_250M682, complete genome) position: , mismatch: 10, identity: 0.697
gctgtcgttattagctgcaataaaaacgaaacc CRISPR spacer
attaaaattatttgctgcaataaaaaagaaagt Protospacer
..*. .***** ************* **** .
475. spacer 1.93|1536514|33|NZ_CP044200|PILER-CR matches to NC_016907 (Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence) position: , mismatch: 10, identity: 0.697
ccgccgattgctgcgccagccacgccaatgacc CRISPR spacer
tgcgtaactgctgcggcagcgacgccaatgacg Protospacer
. ..*.******* **** ***********
476. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 10, identity: 0.688
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
aacaatggcaaaaataataattttctttgatg Protospacer
.**.* ****************** * .
477. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP019552 (Athalassotoga saccharophila strain NAS-01 plasmid pATS1, complete sequence) position: , mismatch: 10, identity: 0.688
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
tctttgatcagaaataatatttttcatattca Protospacer
* . **.******** ***********
478. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP019552 (Athalassotoga saccharophila strain NAS-01 plasmid pATS1, complete sequence) position: , mismatch: 10, identity: 0.688
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
tctttgatcaaaaataatatttttcacattca Protospacer
* . *********** ******.****
479. spacer 2.4|1554735|32|NZ_CP044200|CRISPRCasFinder,CRT matches to NZ_AP019553 (Athalassotoga saccharophila strain NAS-01 plasmid pATS2, complete sequence) position: , mismatch: 10, identity: 0.688
tgcagttgcaaaaataataattttcatattcc CRISPR spacer
tctttgatcagaaataatatttttcatattca Protospacer
* . **.******** ***********
480. spacer 2.9|1555040|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtagcgctcggcgaggcggtgattcccctc CRISPR spacer
gcgaagcgctcggcgaggcggcgagcgaggca Protospacer
*** *****************.** . .
481. spacer 2.9|1555040|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012664 (Defluviimonas alba strain cai42 plasmid pcai42C, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtagcgctcggcgaggcggtgattcccctc CRISPR spacer
cagaagcgcagggcgaggcggtgattcttgag Protospacer
* ***** ****************..
482. spacer 2.9|1555040|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034153 (Rhodococcus sp. NJ-530 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtagcgctcggcgaggcggtgattcccctc CRISPR spacer
cggtagcgctcgtcgcggcggtgatcttgccg Protospacer
********** ** *********... *.
483. spacer 2.11|1555162|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to MW057859 (Providencia phage PSTCR8lys, complete genome) position: , mismatch: 10, identity: 0.688
ggcgtgtcagatgaaatgacgcgggttagcgc CRISPR spacer
ggcgtgtcatatgaaatggcgcgcagatatac Protospacer
********* ********.**** . ...*
484. spacer 1.59|1537917|32|NZ_CP044200|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007648 (Lactobacillus salivarius strain JCM1046 plasmid pMP1046B, complete sequence) position: , mismatch: 11, identity: 0.656
agctttctttttgaaaatacctaacatagtga CRISPR spacer
taatttctttttgaacatatctaacaattcat Protospacer
. ************ ***.****** ..
485. spacer 1.85|1536026|33|NZ_CP044200|PILER-CR matches to NZ_CP038449 (Aeromonas media strain R50-22 plasmid pAeme5, complete sequence) position: , mismatch: 11, identity: 0.667
aagtaaccgcgccatcatgcgggcgcttttttc CRISPR spacer
ctcggcccgcgccatcatccgggcgctgttgcg Protospacer
. ************ ******** ** .
486. spacer 1.85|1536026|33|NZ_CP044200|PILER-CR matches to NZ_CP038446 (Aeromonas media strain R25-3 plasmid pAeme3, complete sequence) position: , mismatch: 11, identity: 0.667
aagtaaccgcgccatcatgcgggcgcttttttc CRISPR spacer
ctcggcccgcgccatcatccgggcgctgttgcg Protospacer
. ************ ******** ** .
