Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP038217 Burkholderia pseudomallei strain Yap7 chromosome 2, complete sequence 1 crisprs csa3,DinG,cas3 0 0 4 0
NZ_CP038216 Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence 3 crisprs DinG,RT,csa3,DEDDh,cas3,WYL 3 3 7 0

Results visualization

1. NZ_CP038216
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038216_1 82187-82342 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038216_2 555103-555436 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038216_3 880984-881125 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP038216_1 1.2|82253|18|NZ_CP038216|CRT 82253-82270 18 NZ_CP038217.1 1258134-1258151 1 0.944
NZ_CP038216_2 2.4|555347|17|NZ_CP038216|CRISPRCasFinder 555347-555363 17 NZ_CP038216.1 2345400-2345416 1 0.941
NZ_CP038216_2 2.5|555392|17|NZ_CP038216|CRISPRCasFinder 555392-555408 17 NZ_CP038216.1 555428-555444 0 1.0
NZ_CP038216_2 2.5|555392|17|NZ_CP038216|CRISPRCasFinder 555392-555408 17 NZ_CP038216.1 555437-555453 0 1.0
NZ_CP038216_2 2.5|555392|17|NZ_CP038216|CRISPRCasFinder 555392-555408 17 NZ_CP038217.1 2404909-2404925 0 1.0
NZ_CP038216_2 2.5|555392|17|NZ_CP038216|CRISPRCasFinder 555392-555408 17 NZ_CP038217.1 2404918-2404934 0 1.0
NZ_CP038216_2 2.5|555392|17|NZ_CP038216|CRISPRCasFinder 555392-555408 17 NZ_CP038217.1 2404900-2404916 1 0.941

1. spacer 1.2|82253|18|NZ_CP038216|CRT matches to position: 1258134-1258151, mismatch: 1, identity: 0.944

cggccgggacatggagcg	CRISPR spacer
cggccgggacattgagcg	Protospacer
************ *****

2. spacer 2.4|555347|17|NZ_CP038216|CRISPRCasFinder matches to position: 2345400-2345416, mismatch: 1, identity: 0.941

ggacgatacggacgata	CRISPR spacer
ggccgatacggacgata	Protospacer
** **************

3. spacer 2.5|555392|17|NZ_CP038216|CRISPRCasFinder matches to position: 555428-555444, mismatch: 0, identity: 1.0

ggacgaggcggacgagg	CRISPR spacer
ggacgaggcggacgagg	Protospacer
*****************

4. spacer 2.5|555392|17|NZ_CP038216|CRISPRCasFinder matches to position: 555437-555453, mismatch: 0, identity: 1.0

ggacgaggcggacgagg	CRISPR spacer
ggacgaggcggacgagg	Protospacer
*****************

5. spacer 2.5|555392|17|NZ_CP038216|CRISPRCasFinder matches to position: 2404909-2404925, mismatch: 0, identity: 1.0

ggacgaggcggacgagg	CRISPR spacer
ggacgaggcggacgagg	Protospacer
*****************

6. spacer 2.5|555392|17|NZ_CP038216|CRISPRCasFinder matches to position: 2404918-2404934, mismatch: 0, identity: 1.0

ggacgaggcggacgagg	CRISPR spacer
ggacgaggcggacgagg	Protospacer
*****************

7. spacer 2.5|555392|17|NZ_CP038216|CRISPRCasFinder matches to position: 2404900-2404916, mismatch: 1, identity: 0.941

ggacgaggcggacgagg	CRISPR spacer
ggacgaggccgacgagg	Protospacer
********* *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NC_008758 Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence 144302-144331 7 0.767
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 MG018224 Stenotrophomonas phage DLP4, complete genome 6658-6687 7 0.767
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 240347-240376 7 0.767
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 KT809302 Haloarcula californiae icosahedral virus 1, complete genome 11055-11084 7 0.767
NZ_CP038216_2 2.1|555131|29|NZ_CP038216|CRISPRCasFinder 555131-555159 29 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 121693-121721 7 0.759
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4863580-4863609 8 0.733
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_CP008954 Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence 71166-71195 8 0.733
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 417092-417121 8 0.733
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 403911-403940 8 0.733
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 417092-417121 8 0.733
NZ_CP038216_1 1.1|82205|30|NZ_CP038216|CRT 82205-82234 30 NZ_CP026567 Pseudomonas avellanae strain R2leaf plasmid p5_tig9, complete sequence 10737-10766 9 0.7
NZ_CP038216_1 1.3|82289|36|NZ_CP038216|CRT 82289-82324 36 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 201580-201615 9 0.75
NZ_CP038216_1 1.3|82289|36|NZ_CP038216|CRT 82289-82324 36 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 384570-384605 10 0.722

1. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NC_008758 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence) position: , mismatch: 7, identity: 0.767

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
tcgttctggcggcggtggctacggtggtgg	Protospacer
  *.  **.**.******************

2. spacer 1.1|82205|30|NZ_CP038216|CRT matches to MG018224 (Stenotrophomonas phage DLP4, complete genome) position: , mismatch: 7, identity: 0.767

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
cgacggtgacgacggtgacgacggtgagag	Protospacer
 *.**************.* ******. .*

3. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
gggcgatgacgacggtggctccggcgaaga	Protospacer
.****.************** ***.*. *.

4. spacer 1.1|82205|30|NZ_CP038216|CRT matches to KT809302 (Haloarcula californiae icosahedral virus 1, complete genome) position: , mismatch: 7, identity: 0.767

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
cgacggtgacgacggcggcgacggtgacga	Protospacer
 *.************.*** ******..*.

5. spacer 2.1|555131|29|NZ_CP038216|CRISPRCasFinder matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

ggccgcctcggcgagcatagtccgggccg	CRISPR spacer
cgccgcctcggcgagcatggtcttgccgt	Protospacer
 *****************.***. * *  

6. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
acagggtggcgacggtggcaacggtggctc	Protospacer
* . ****.********** *******.  

7. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_CP008954 (Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence) position: , mismatch: 8, identity: 0.733

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
tcgtcgtgacgacggtggcttcgctggtct	Protospacer
  *. *************** ** ****  

8. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.733

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
tatcggtgacgacggtggcttcggagttca	Protospacer
 . ***************** *** * * .

9. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.733

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
tatcggtgacgacggtggcttcggagttca	Protospacer
 . ***************** *** * * .

10. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.733

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
tatcggtgacgacggtggcttcggagttca	Protospacer
 . ***************** *** * * .

11. spacer 1.1|82205|30|NZ_CP038216|CRT matches to NZ_CP026567 (Pseudomonas avellanae strain R2leaf plasmid p5_tig9, complete sequence) position: , mismatch: 9, identity: 0.7

aggcggtgacgacggtggctacggtggtgg	CRISPR spacer
caacggtggctacggtggctacggtgagtt	Protospacer
 ..*****.* ***************.   

12. spacer 1.3|82289|36|NZ_CP038216|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.75

tgcgtcgggtggcggcggcgcgggtgcgcgcagcgg	CRISPR spacer
gggcgcgggtggcggtggcgcgggcgcgcgcgtcgc	Protospacer
 *   **********.********.******. ** 

13. spacer 1.3|82289|36|NZ_CP038216|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.722

tgcgtcgggtggcggcggcgcgggtgcgcgcagcgg	CRISPR spacer
cgaaccccatggcggcggcgagggtgcgcgcatcga	Protospacer
.* ..*  .*********** *********** **.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 442627 : 453603 11 Streptococcus_phage(16.67%) protease NA
DBSCAN-SWA_2 992638 : 999414 11 Burkholderia_virus(33.33%) integrase attL 990441:990461|attR 1016132:1016152
DBSCAN-SWA_3 2051696 : 2124679 94 uncultured_Caudovirales_phage(26.32%) portal,head,protease,tail,plate,terminase,tRNA,capsid,integrase attL 2096034:2096051|attR 2113722:2113739
DBSCAN-SWA_4 2413089 : 2421977 9 Tanapox_virus(16.67%) NA NA
DBSCAN-SWA_5 2759238 : 2768493 7 unidentified_phage(16.67%) NA NA
DBSCAN-SWA_6 3052973 : 3111301 61 Burkholderia_phage(27.27%) tail,plate,tRNA,transposase,integrase attL 3057194:3057211|attR 3114495:3114512
DBSCAN-SWA_7 3333836 : 3345065 11 Burkholderia_phage(22.22%) integrase attL 3335109:3335125|attR 3342950:3342966
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP038217
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038217_1 235095-235187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15997 : 70609 42 Leptospira_phage(16.67%) transposase,plate NA
DBSCAN-SWA_2 436613 : 479918 37 Streptococcus_phage(20.0%) integrase,portal,protease,transposase,tRNA attL 444161:444177|attR 486606:486622
DBSCAN-SWA_3 1611488 : 1722427 72 Burkholderia_phage(91.49%) integrase,protease,terminase,transposase,tail,plate attL 1641324:1641343|attR 1712122:1712141
DBSCAN-SWA_4 2720762 : 2785317 53 Xanthomonas_phage(20.0%) holin,transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage