Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044334 Xanthomonas arboricola pv. pruni strain 15-088 chromosome, complete genome 3 crisprs cas3,WYL,DEDDh,DinG,csa3 0 1 6 0

Results visualization

1. NZ_CP044334
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044334_1 2531872-2531972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044334_2 2644489-2644601 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044334_3 3012114-3012191 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044334_3 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder 3012140-3012165 26 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 186968-186993 4 0.846
NZ_CP044334_3 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder 3012140-3012165 26 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 108342-108367 4 0.846
NZ_CP044334_3 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder 3012140-3012165 26 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 118022-118047 4 0.846
NZ_CP044334_3 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder 3012140-3012165 26 NZ_CP016288 Rhizobium leguminosarum strain Vaf10 plasmid unnamed7, complete sequence 179815-179840 5 0.808

1. spacer 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgatgaggccttcccgccggcacc	CRISPR spacer
ggcgatgaggccttgccggcggcgcg	Protospacer
************** *** ****.* 

2. spacer 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgatgaggccttcccgccggcacc	CRISPR spacer
ggcgatgaggccttgccggcggcgcg	Protospacer
************** *** ****.* 

3. spacer 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgatgaggccttcccgccggcacc	CRISPR spacer
ggcgatgaggccttgccggcggcgcg	Protospacer
************** *** ****.* 

4. spacer 3.1|3012140|26|NZ_CP044334|CRISPRCasFinder matches to NZ_CP016288 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgatgaggccttcccgccggcacc	CRISPR spacer
ggcgatcaggccttcccgcgggccgt	Protospacer
****** ************ ***  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 281327 : 292834 18 Xanthomonas_phage(83.33%) NA NA
DBSCAN-SWA_2 763324 : 883844 111 Stenotrophomonas_phage(50.0%) terminase,plate,head,tRNA,holin,tail,integrase,capsid,transposase,portal attL 784590:784649|attR 850790:851988
DBSCAN-SWA_3 2768576 : 2838596 60 Arthrobacter_phage(27.27%) tail,tRNA,protease NA
DBSCAN-SWA_4 3382852 : 3460658 78 Stenotrophomonas_phage(50.0%) terminase,plate,head,tRNA,holin,tail,integrase,capsid,transposase,portal attL 3393816:3393835|attR 3448905:3448924
DBSCAN-SWA_5 3656040 : 3662420 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_6 4629912 : 4695300 50 Klosneuvirus(18.18%) plate,tRNA,tail,transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage