Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044344 Nocardioides sp. SB3-45 chromosome, complete genome 4 crisprs WYL,cas4,casR,DEDDh,cas3,DinG,csa3 0 1 0 0

Results visualization

1. NZ_CP044344
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044344_1 77226-77314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044344_2 454050-454144 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044344_3 2431952-2432034 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044344_4 3893508-3893623 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044344_1 1.1|77256|29|NZ_CP044344|CRISPRCasFinder 77256-77284 29 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 540657-540685 7 0.759
NZ_CP044344_1 1.1|77256|29|NZ_CP044344|CRISPRCasFinder 77256-77284 29 MN234216 Streptomyces phage Gilgamesh, complete genome 51639-51667 7 0.759
NZ_CP044344_1 1.1|77256|29|NZ_CP044344|CRISPRCasFinder 77256-77284 29 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 506747-506775 7 0.759

1. spacer 1.1|77256|29|NZ_CP044344|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.759

ccatctcggtggtcgcgcaccatctcggt	CRISPR spacer
agcgctctgtggccgcgcaccatctcgct	Protospacer
    *** ****.************** *

2. spacer 1.1|77256|29|NZ_CP044344|CRISPRCasFinder matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 7, identity: 0.759

ccatctcggtggtcgcgcaccatctcggt	CRISPR spacer
acgcgacggtggacgcggaccatctcggt	Protospacer
 *..  ****** **** ***********

3. spacer 1.1|77256|29|NZ_CP044344|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.759

ccatctcggtggtcgcgcaccatctcggt	CRISPR spacer
agcgctctgtggccgcgcaccatctcgct	Protospacer
    *** ****.************** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage