Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031700 Neisseria zalophi strain ATCC BAA-2455 chromosome, complete genome 2 crisprs DinG,DEDDh,csa3,WYL,RT,cas3 0 1 4 0

Results visualization

1. NZ_CP031700
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031700_1 131302-131538 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031700_2 687773-687873 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031700_1 1.1|131335|34|NZ_CP031700|PILER-CR,CRISPRCasFinder,CRT 131335-131368 34 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 172404-172437 8 0.765
NZ_CP031700_1 1.1|131335|34|NZ_CP031700|PILER-CR,CRISPRCasFinder,CRT 131335-131368 34 NZ_CP054057 Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence 29678-29711 10 0.706

1. spacer 1.1|131335|34|NZ_CP031700|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.765

ggcggccttg---ttgttaagcaaggcagcgcgcccg	CRISPR spacer
---tatcttgcgcttgataagcaaggcagagcgcccg	Protospacer
    ..****   *** ************ *******

2. spacer 1.1|131335|34|NZ_CP031700|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054057 (Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcggccttgttgttaagcaaggcagcgcgcccg	CRISPR spacer
cgcggccttgttcttgagcaaggcagtcttgtct	Protospacer
 *********** **.**********. .  .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1321643 : 1369647 34 uncultured_Caudovirales_phage(70.0%) plate,transposase NA
DBSCAN-SWA_2 1566548 : 1613236 46 Agrobacterium_phage(15.38%) protease,transposase NA
DBSCAN-SWA_3 1656374 : 1664385 8 Indivirus(16.67%) NA NA
DBSCAN-SWA_4 2392226 : 2400250 7 Erwinia_phage(16.67%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage