Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042930 Leclercia adecarboxylata strain J656 chromosome, complete genome 8 crisprs DinG,DEDDh,csa3,WYL,cas3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 0 65 5 0

Results visualization

1. NZ_CP042930
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_1 2010989-2011119 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_2 3248358-3248476 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_3 3322192-3325373 Orphan NA
52 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_4 3591589-3591677 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_5 3675526-3675612 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_6 3728940-3731516 TypeI-E I-E
41 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_7 3940293-3940382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042930_8 4683941-4684038 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534546-534579 0 1.0
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79422-79443 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900315-900336 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320451-320472 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320457-320478 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320463-320484 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320469-320490 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320475-320496 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320481-320502 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320487-320508 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320493-320514 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320499-320520 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320505-320526 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378043-378064 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378049-378070 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741209-1741230 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741215-1741236 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741221-1741242 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741227-1741248 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741233-1741254 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741239-1741260 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741245-1741266 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741251-1741272 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741257-1741278 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741263-1741284 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741269-1741290 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19180-19201 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19984-20005 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93605-93626 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93611-93632 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93617-93638 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93623-93644 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93629-93650 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93635-93656 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93641-93662 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798684-1798705 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798690-1798711 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798696-1798717 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798702-1798723 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798708-1798729 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141134-1141155 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141140-1141161 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141146-1141167 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141152-1141173 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141158-1141179 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141164-1141185 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141170-1141191 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141176-1141197 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141182-1141203 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828207-1828228 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828213-1828234 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972464-1972485 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972470-1972491 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972476-1972497 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972482-1972503 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972488-1972509 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972494-1972515 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972500-1972521 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972506-1972527 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972512-1972533 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972518-1972539 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972524-1972545 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972530-1972551 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972536-1972557 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451010-1451031 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451016-1451037 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451022-1451043 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451028-1451049 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451034-1451055 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451040-1451061 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451046-1451067 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451052-1451073 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451058-1451079 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730608-1730629 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566024-566045 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566030-566051 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566036-566057 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566042-566063 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566048-566069 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566054-566075 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566060-566081 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566066-566087 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566072-566093 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566078-566099 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808180-1808201 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808186-1808207 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808192-1808213 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668808-668829 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668814-668835 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668820-668841 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668826-668847 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668832-668853 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668838-668859 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668844-668865 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668850-668871 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748469-1748490 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748475-1748496 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748481-1748502 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748487-1748508 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748493-1748514 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748499-1748520 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748505-1748526 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748511-1748532 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748517-1748538 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748523-1748544 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743290-1743311 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743296-1743317 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743302-1743323 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743308-1743329 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743314-1743335 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743320-1743341 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743326-1743347 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743332-1743353 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743338-1743359 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743344-1743365 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743350-1743371 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743356-1743377 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743362-1743383 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743368-1743389 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743374-1743395 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743380-1743401 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743386-1743407 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743392-1743413 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814112-1814133 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814118-1814139 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814124-1814145 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814130-1814151 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814136-1814157 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814142-1814163 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814148-1814169 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814154-1814175 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814160-1814181 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686286-1686307 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686292-1686313 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686298-1686319 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686304-1686325 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686310-1686331 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686316-1686337 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686322-1686343 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686328-1686349 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686334-1686355 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686340-1686361 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686346-1686367 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686352-1686373 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686358-1686379 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744743-1744764 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744749-1744770 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744755-1744776 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744761-1744782 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819660-1819681 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819666-1819687 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819672-1819693 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814079-1814100 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814085-1814106 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814091-1814112 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814097-1814118 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814103-1814124 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814109-1814130 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814115-1814136 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814121-1814142 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814127-1814148 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721563-1721584 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721569-1721590 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721575-1721596 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721581-1721602 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721587-1721608 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721593-1721614 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721599-1721620 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721605-1721626 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799101-1799122 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799107-1799128 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812822-1812843 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812828-1812849 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812834-1812855 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812840-1812861 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812846-1812867 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812852-1812873 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812858-1812879 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812864-1812885 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812870-1812891 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828209-1828230 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708033-1708054 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708039-1708060 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708045-1708066 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708051-1708072 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708057-1708078 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708063-1708084 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708069-1708090 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721875-1721896 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721881-1721902 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721887-1721908 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721893-1721914 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721899-1721920 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721905-1721926 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721911-1721932 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721917-1721938 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799101-1799122 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799107-1799128 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812921-1812942 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812927-1812948 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812933-1812954 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812939-1812960 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812945-1812966 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812951-1812972 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812957-1812978 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812963-1812984 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812969-1812990 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721563-1721584 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721569-1721590 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721575-1721596 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721581-1721602 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721587-1721608 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721593-1721614 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721599-1721620 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721605-1721626 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708680-1708701 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708686-1708707 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708692-1708713 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708698-1708719 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708704-1708725 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708710-1708731 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708716-1708737 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720766-1720787 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720772-1720793 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720778-1720799 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720784-1720805 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720790-1720811 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720796-1720817 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720802-1720823 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720808-1720829 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799101-1799122 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799107-1799128 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799101-1799122 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799107-1799128 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799101-1799122 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799107-1799128 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812917-1812938 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812923-1812944 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812929-1812950 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812935-1812956 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812941-1812962 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812947-1812968 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812953-1812974 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812959-1812980 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812965-1812986 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812906-1812927 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812912-1812933 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812918-1812939 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812924-1812945 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812930-1812951 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812936-1812957 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812942-1812963 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812948-1812969 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812954-1812975 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708056-1708077 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708062-1708083 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708068-1708089 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708074-1708095 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708080-1708101 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708086-1708107 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708092-1708113 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765435-1765456 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797417-1797438 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797423-1797444 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796416-1796437 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796422-1796443 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812906-1812927 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812912-1812933 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812918-1812939 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812924-1812945 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812930-1812951 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812936-1812957 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812942-1812963 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812948-1812969 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812954-1812975 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708056-1708077 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708062-1708083 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708068-1708089 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708074-1708095 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708080-1708101 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708086-1708107 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708092-1708113 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721874-1721895 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721880-1721901 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721886-1721907 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721892-1721913 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721898-1721919 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721904-1721925 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721910-1721931 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721916-1721937 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813903-1813924 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813909-1813930 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813915-1813936 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813921-1813942 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813927-1813948 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813933-1813954 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813939-1813960 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813945-1813966 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813951-1813972 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708056-1708077 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708062-1708083 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708068-1708089 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708074-1708095 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708080-1708101 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708086-1708107 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708092-1708113 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708056-1708077 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708062-1708083 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708068-1708089 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708074-1708095 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708080-1708101 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708086-1708107 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708092-1708113 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812917-1812938 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812923-1812944 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812929-1812950 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812935-1812956 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812941-1812962 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812947-1812968 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812953-1812974 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812959-1812980 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812965-1812986 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799106-1799127 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799112-1799133 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812928-1812949 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812934-1812955 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812940-1812961 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812946-1812967 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812952-1812973 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812958-1812979 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812964-1812985 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812970-1812991 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812976-1812997 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812729-1812750 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812735-1812756 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812741-1812762 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812747-1812768 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812753-1812774 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812759-1812780 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812765-1812786 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812771-1812792 0 1.0
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812777-1812798 0 1.0
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20446-20467 1 0.955
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791679-791706 1 0.964
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18874-18901 1 0.964
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19234-19261 1 0.964
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533901-533928 1 0.964
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804694-804721 1 0.964
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533499-533532 1 0.971
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18910-18943 1 0.971
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19006-19039 1 0.971
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490890-490923 1 0.971
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804210-804243 1 0.971
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804292-804325 1 0.971
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 CP003674 Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence 37-64 1 0.964
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458182-458215 1 0.971
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590826-590847 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900315-900336 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320451-320472 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320457-320478 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320463-320484 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320469-320490 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320475-320496 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320481-320502 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320487-320508 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320493-320514 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320499-320520 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320505-320526 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378043-378064 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378049-378070 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741209-1741230 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741215-1741236 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741221-1741242 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741227-1741248 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741233-1741254 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741239-1741260 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741245-1741266 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741251-1741272 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741257-1741278 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741263-1741284 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741269-1741290 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19162-19183 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19180-19201 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19984-20005 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93605-93626 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93611-93632 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93617-93638 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93623-93644 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93629-93650 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93635-93656 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93641-93662 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798684-1798705 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798690-1798711 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798696-1798717 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798702-1798723 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798708-1798729 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141134-1141155 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141140-1141161 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141146-1141167 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141152-1141173 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141158-1141179 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141164-1141185 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141170-1141191 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141176-1141197 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141182-1141203 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828207-1828228 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828213-1828234 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972464-1972485 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972470-1972491 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972476-1972497 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972482-1972503 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972488-1972509 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972494-1972515 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972500-1972521 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972506-1972527 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972512-1972533 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972518-1972539 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972524-1972545 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972530-1972551 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972536-1972557 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451010-1451031 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451016-1451037 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451022-1451043 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451028-1451049 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451034-1451055 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451040-1451061 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451046-1451067 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451052-1451073 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451058-1451079 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730608-1730629 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566024-566045 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566030-566051 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566036-566057 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566042-566063 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566048-566069 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566054-566075 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566060-566081 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566066-566087 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566072-566093 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566078-566099 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808180-1808201 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808186-1808207 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808192-1808213 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668808-668829 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668814-668835 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668820-668841 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668826-668847 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668832-668853 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668838-668859 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668844-668865 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668850-668871 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748469-1748490 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748475-1748496 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748481-1748502 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748487-1748508 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748493-1748514 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748499-1748520 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748505-1748526 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748511-1748532 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748517-1748538 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748523-1748544 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743290-1743311 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743296-1743317 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743302-1743323 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743308-1743329 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743314-1743335 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743320-1743341 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743326-1743347 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743332-1743353 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743338-1743359 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743344-1743365 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743350-1743371 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743356-1743377 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743362-1743383 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743368-1743389 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743374-1743395 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743380-1743401 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743386-1743407 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743392-1743413 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814112-1814133 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814118-1814139 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814124-1814145 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814130-1814151 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814136-1814157 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814142-1814163 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814148-1814169 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814154-1814175 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814160-1814181 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490878-490899 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490902-490923 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491250-491271 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686286-1686307 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686292-1686313 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686298-1686319 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686304-1686325 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686310-1686331 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686316-1686337 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686322-1686343 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686328-1686349 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686334-1686355 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686340-1686361 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686346-1686367 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686352-1686373 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686358-1686379 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744743-1744764 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744749-1744770 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744755-1744776 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744761-1744782 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819660-1819681 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819666-1819687 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819672-1819693 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814079-1814100 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814085-1814106 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814091-1814112 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814097-1814118 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814103-1814124 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814109-1814130 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814115-1814136 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814121-1814142 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814127-1814148 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721563-1721584 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721569-1721590 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721575-1721596 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721581-1721602 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721587-1721608 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721593-1721614 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721599-1721620 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721605-1721626 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799101-1799122 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799107-1799128 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812822-1812843 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812828-1812849 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812834-1812855 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812840-1812861 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812846-1812867 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812852-1812873 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812858-1812879 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812864-1812885 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812870-1812891 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828209-1828230 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708033-1708054 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708039-1708060 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708045-1708066 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708051-1708072 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708057-1708078 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708063-1708084 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708069-1708090 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721875-1721896 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721881-1721902 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721887-1721908 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721893-1721914 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721899-1721920 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721905-1721926 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721911-1721932 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721917-1721938 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799101-1799122 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799107-1799128 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812921-1812942 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812927-1812948 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812933-1812954 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812939-1812960 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812945-1812966 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812951-1812972 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812957-1812978 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812963-1812984 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812969-1812990 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721563-1721584 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721569-1721590 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721575-1721596 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721581-1721602 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721587-1721608 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721593-1721614 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721599-1721620 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721605-1721626 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708680-1708701 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708686-1708707 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708692-1708713 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708698-1708719 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708704-1708725 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708710-1708731 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708716-1708737 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720766-1720787 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720772-1720793 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720778-1720799 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720784-1720805 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720790-1720811 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720796-1720817 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720802-1720823 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720808-1720829 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799101-1799122 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799107-1799128 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799101-1799122 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799107-1799128 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799101-1799122 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799107-1799128 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812917-1812938 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812923-1812944 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812929-1812950 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812935-1812956 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812941-1812962 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812947-1812968 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812953-1812974 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812959-1812980 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812965-1812986 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812906-1812927 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812912-1812933 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812918-1812939 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812924-1812945 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812930-1812951 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812936-1812957 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812942-1812963 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812948-1812969 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812954-1812975 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708056-1708077 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708062-1708083 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708068-1708089 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708074-1708095 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708080-1708101 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708086-1708107 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708092-1708113 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765435-1765456 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797417-1797438 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797423-1797444 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796416-1796437 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796422-1796443 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812906-1812927 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812912-1812933 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812918-1812939 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812924-1812945 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812930-1812951 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812936-1812957 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812942-1812963 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812948-1812969 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812954-1812975 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708056-1708077 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708062-1708083 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708068-1708089 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708074-1708095 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708080-1708101 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708086-1708107 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708092-1708113 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721874-1721895 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721880-1721901 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721886-1721907 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721892-1721913 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721898-1721919 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721904-1721925 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721910-1721931 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721916-1721937 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813903-1813924 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813909-1813930 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813915-1813936 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813921-1813942 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813927-1813948 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813933-1813954 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813939-1813960 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813945-1813966 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813951-1813972 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708056-1708077 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708062-1708083 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708068-1708089 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708074-1708095 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708080-1708101 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708086-1708107 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708092-1708113 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708056-1708077 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708062-1708083 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708068-1708089 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708074-1708095 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708080-1708101 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708086-1708107 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708092-1708113 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812917-1812938 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812923-1812944 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812929-1812950 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812935-1812956 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812941-1812962 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812947-1812968 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812953-1812974 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812959-1812980 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812965-1812986 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799106-1799127 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799112-1799133 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812928-1812949 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812934-1812955 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812940-1812961 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812946-1812967 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812952-1812973 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812958-1812979 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812964-1812985 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812970-1812991 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812976-1812997 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812729-1812750 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812735-1812756 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812741-1812762 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812747-1812768 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812753-1812774 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812759-1812780 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812765-1812786 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812771-1812792 1 0.955
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812777-1812798 1 0.955
NZ_CP042930_3 3.39|3324564|22|NZ_CP042930|CRT 3324564-3324585 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491190-491211 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 CP003674 Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence 31-52 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18880-18901 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19240-19261 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20068-20089 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20098-20119 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533907-533928 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458806-458827 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590183-590204 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490104-490125 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491208-491229 1 0.955
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804700-804721 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900321-900342 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320511-320532 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378037-378058 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741203-1741224 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19084-19105 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19090-19111 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19174-19195 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19186-19207 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19978-19999 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19990-20011 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18928-18949 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19024-19045 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93647-93668 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798678-1798699 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141188-1141209 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828201-1828222 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972458-1972479 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451004-1451025 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730602-1730623 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566084-566105 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808174-1808195 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668856-668877 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748463-1748484 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743284-1743305 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814106-1814127 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686280-1686301 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744737-1744758 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819654-1819675 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814073-1814094 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721557-1721578 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799095-1799116 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812816-1812837 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828203-1828224 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708027-1708048 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721869-1721890 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799095-1799116 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812915-1812936 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721557-1721578 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708674-1708695 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720760-1720781 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799095-1799116 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799095-1799116 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799095-1799116 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812911-1812932 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812900-1812921 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708050-1708071 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765429-1765450 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797411-1797432 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796410-1796431 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812900-1812921 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708050-1708071 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721868-1721889 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813897-1813918 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708050-1708071 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708050-1708071 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812911-1812932 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799100-1799121 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812922-1812943 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812723-1812744 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1515798-1515819 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP035508 Haematobacter massiliensis strain OT1 plasmid pOT1-8, complete sequence 39967-39988 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490890-490911 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491262-491283 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490878-490899 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490884-490905 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490896-490917 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490902-490923 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 233127-233148 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1723740-1723761 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1704379-1704400 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 78784-78805 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 140260-140281 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590682-590703 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590832-590853 1 0.955
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1825109-1825130 1 0.955
NZ_CP042930_3 3.52|3325332|22|NZ_CP042930|CRT 3325332-3325353 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19924-19945 1 0.955
NZ_CP042930_3 3.52|3325332|22|NZ_CP042930|CRT 3325332-3325353 22 NC_016907 Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence 155376-155397 1 0.955
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MT261384 Salmonella virus PAT1, complete genome 34703-34734 1 0.969
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MT580116 Salmonella phage 65FD, complete genome 8281-8312 1 0.969
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MT580117 Salmonella phage 66FD, complete genome 40320-40351 1 0.969
NZ_CP042930_3 3.7|3322722|22|NZ_CP042930|CRT 3322722-3322743 22 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79386-79407 2 0.909
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19078-19105 2 0.929
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590520-590541 2 0.909
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491532-491553 2 0.909
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NC_016601 Pseudonocardia dioxanivorans CB1190 plasmid pPSED02, complete sequence 26478-26499 2 0.909
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 24098-24119 2 0.909
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19438-19471 2 0.941
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113223-113256 2 0.941
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20332-20359 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18832-18859 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19588-19615 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19696-19723 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19906-19933 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19954-19981 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534552-534579 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533643-533670 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533781-533808 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533805-533832 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534540-534567 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458728-458755 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458860-458887 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458182-458209 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458422-458449 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458464-458491 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458602-458629 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458848-458875 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804436-804463 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804574-804601 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804598-804625 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805498-805525 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143612-143639 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143618-143645 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143624-143651 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143630-143657 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143636-143663 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165763-165790 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802327-1802354 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802333-1802360 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139686-139713 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141186-141213 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166090-166117 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167587-167614 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124396-124423 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26447-26474 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26453-26480 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26459-26486 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26465-26492 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26471-26498 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26447-26474 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26453-26480 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26459-26486 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26465-26492 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26471-26498 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26477-26504 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26448-26475 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26454-26481 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26460-26487 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26466-26493 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26472-26499 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2014-2041 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2020-2047 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590141-590168 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590454-590481 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590868-590895 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233566-233593 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113211-113238 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113217-113244 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113223-113250 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490050-490077 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490722-490749 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490866-490893 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490872-490899 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490998-491025 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491202-491229 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2991-3018 2 0.929
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2997-3024 2 0.929
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533649-533682 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533967-534000 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533979-534012 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534291-534324 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18898-18931 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18922-18955 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19258-19291 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19690-19723 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19702-19735 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20314-20347 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20326-20359 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490878-490911 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490866-490899 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804442-804475 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804760-804793 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804772-804805 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805084-805117 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458842-458875 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458854-458887 2 0.941
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233656-233689 2 0.941
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108258-108285 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79572-79599 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79866-79893 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28648-28675 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28780-28807 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29044-29071 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29308-29335 2 0.929
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29404-29431 2 0.929
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458602-458635 2 0.941
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233686-233719 2 0.941
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19786-19819 2 0.941
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19882-19915 2 0.941
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590676-590697 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900321-900342 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320511-320532 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378037-378058 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741203-1741224 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18922-18943 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19084-19105 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19090-19111 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19174-19195 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19186-19207 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19546-19567 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19564-19585 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19702-19723 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19786-19807 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19882-19903 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19978-19999 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19990-20011 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20326-20347 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93647-93668 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798678-1798699 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828201-1828222 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972458-1972479 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451004-1451025 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730602-1730623 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566084-566105 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808174-1808195 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668856-668877 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748463-1748484 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743284-1743305 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814106-1814127 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490422-490443 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490512-490533 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490890-490911 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491022-491043 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491262-491283 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686280-1686301 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744737-1744758 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819654-1819675 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814073-1814094 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721557-1721578 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799095-1799116 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812816-1812837 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828203-1828224 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708027-1708048 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721869-1721890 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799095-1799116 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812915-1812936 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721557-1721578 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708674-1708695 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720760-1720781 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799095-1799116 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799095-1799116 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799095-1799116 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812911-1812932 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812900-1812921 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708050-1708071 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765429-1765450 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797411-1797432 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796410-1796431 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812900-1812921 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708050-1708071 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721868-1721889 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813897-1813918 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708050-1708071 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708050-1708071 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812911-1812932 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799100-1799121 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812922-1812943 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812723-1812744 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534105-534126 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534291-534312 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534546-534567 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534558-534579 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458854-458875 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233584-233605 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233596-233617 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1515798-1515819 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP035507 Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence 11074-11095 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP035508 Haematobacter massiliensis strain OT1 plasmid pOT1-8, complete sequence 39967-39988 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804898-804919 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805084-805105 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805504-805525 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 233127-233148 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1723740-1723761 2 0.909
NZ_CP042930_3 3.32|3324216|22|NZ_CP042930|CRT 3324216-3324237 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1704379-1704400 2 0.909
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791775-791802 2 0.929
NZ_CP042930_3 3.39|3324564|22|NZ_CP042930|CRT 3324564-3324585 22 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791697-791718 2 0.909
NZ_CP042930_3 3.39|3324564|22|NZ_CP042930|CRT 3324564-3324585 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233638-233659 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79950-79971 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108180-108201 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19606-19627 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19750-19771 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20224-20245 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458452-458473 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458542-458563 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458734-458755 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458866-458887 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590742-590763 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491028-491049 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491304-491325 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491418-491439 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491508-491529 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233458-233479 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233506-233527 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233614-233635 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233644-233665 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 286727-286748 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132913-132934 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140562-140583 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142104-142125 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165179-165200 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166718-166739 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 867879-867900 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171832-171853 2 0.909
NZ_CP042930_3 3.41|3324666|22|NZ_CP042930|CRT 3324666-3324687 22 MN693976 Marine virus AFVG_250M247, complete genome 33570-33591 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378055-378076 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18934-18955 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19030-19051 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19210-19231 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19282-19303 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19480-19501 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20134-20155 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18922-18943 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19168-19189 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19444-19465 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19588-19609 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19702-19723 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20326-20347 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490164-490185 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491070-491091 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490476-490497 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490866-490887 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490872-490893 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490908-490929 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491064-491085 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491256-491277 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491268-491289 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 78778-78799 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534762-534783 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533517-533538 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534309-534330 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534546-534567 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534558-534579 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590093-590114 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590688-590709 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590838-590859 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590826-590847 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804264-804285 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804228-804249 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805708-805729 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804310-804331 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805102-805123 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805276-805297 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805282-805303 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805504-805525 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP049032 Fluviibacterium aquatile strain SC52 plasmid pSC52_4, complete sequence 18869-18890 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458854-458875 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 98009-98030 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_AP014708 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence 49814-49835 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 173681-173702 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 MN693610 Marine virus AFVG_250M347, complete genome 12032-12053 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 MN693983 Marine virus AFVG_250M348, complete genome 41728-41749 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 MN693937 Marine virus AFVG_250M350, complete genome 41667-41688 2 0.909
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 MN694384 Marine virus AFVG_250M349, complete genome 41485-41506 2 0.909
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 KC911857 Salmonella phage SPC32N, complete genome 9395-9426 2 0.938
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 KC911856 Salmonella phage SPC32H, complete genome 9395-9426 2 0.938
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NC_016761 Salmonella phage SPN1S, complete genome 9423-9454 2 0.938
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 JQ691610 Salmonella phage SPN9TCW, complete genome 9424-9455 2 0.938
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NC_004775 Enterobacteria phage epsilon15, complete genome 9152-9183 2 0.938
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19474-19501 3 0.893
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20128-20155 3 0.893
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20320-20347 3 0.893
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491058-491085 3 0.893
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82143-82164 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82149-82170 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82155-82176 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82161-82182 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82167-82188 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82173-82194 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82179-82200 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82185-82206 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81662-81683 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81668-81689 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81674-81695 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81680-81701 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81686-81707 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81692-81713 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81698-81719 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26239-26260 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26245-26266 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26251-26272 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26257-26278 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26263-26284 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26269-26290 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP033584 Streptomyces sp. ADI95-16 plasmid pADI95-16c, complete sequence 661-682 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 MN582058 Caudovirales sp. ctOwN3, complete genome 17304-17325 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 MN582058 Caudovirales sp. ctOwN3, complete genome 17310-17331 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 MN582058 Caudovirales sp. ctOwN3, complete genome 17316-17337 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78252-78273 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78258-78279 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78264-78285 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78270-78291 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78276-78297 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78282-78303 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78288-78309 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78294-78315 3 0.864
NZ_CP042930_3 3.10|3322878|22|NZ_CP042930|CRT 3322878-3322899 22 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78300-78321 3 0.864
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113211-113244 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113217-113250 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143612-143645 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143618-143651 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143624-143657 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143630-143663 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802327-1802360 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132931-132964 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132955-132988 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133015-133048 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26447-26480 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26453-26486 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26459-26492 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26465-26498 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26447-26480 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26453-26486 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26459-26492 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26465-26498 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26471-26504 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26448-26481 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26454-26487 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26460-26493 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26466-26499 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2014-2047 3 0.912
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2991-3024 3 0.912
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590508-590541 3 0.912
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791685-791712 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18892-18919 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18904-18931 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18916-18943 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19012-19039 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19036-19063 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19054-19081 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19252-19279 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19264-19291 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19354-19381 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19444-19471 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19450-19477 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19552-19579 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19642-19669 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19708-19735 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19996-20023 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20140-20167 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20278-20305 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20320-20347 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534468-534495 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533505-533532 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533847-533874 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533919-533946 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533961-533988 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534201-534228 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534636-534663 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458158-458185 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458338-458365 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458362-458389 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805426-805453 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804298-804325 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804640-804667 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804712-804739 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804754-804781 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804994-805021 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805582-805609 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165769-165796 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720567-720594 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132913-132940 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139626-139653 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139632-139659 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139680-139707 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141180-141207 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166096-166123 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167593-167620 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167641-167668 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167647-167674 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124402-124429 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2026-2053 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590165-590192 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590177-590204 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590305-590332 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590378-590405 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590556-590583 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590718-590745 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590778-590805 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233476-233503 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233536-233563 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233650-233677 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233662-233689 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233686-233713 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113229-113256 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491034-491061 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491376-491403 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490098-490125 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490800-490827 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490884-490911 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490896-490923 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490932-490959 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491064-491091 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491172-491199 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491346-491373 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491412-491439 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2985-3012 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 17245-17272 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP003674 Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence 31-58 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467917-1467944 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108180-108207 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79416-79443 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79944-79971 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453478-1453505 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 161431-161458 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720526-720553 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376261-376288 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720377-720404 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804216-804243 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720355-720382 3 0.893
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1657467-1657494 3 0.893
NZ_CP042930_3 3.17|3323268|40|NZ_CP042930|CRT 3323268-3323307 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139608-139647 3 0.925
NZ_CP042930_3 3.17|3323268|40|NZ_CP042930|CRT 3323268-3323307 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167653-167692 3 0.925
NZ_CP042930_3 3.26|3323898|40|NZ_CP042930|CRT 3323898-3323937 40 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590490-590529 3 0.925
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533487-533520 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533787-533820 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533853-533886 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533865-533898 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534237-534270 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534249-534282 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534558-534591 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19018-19051 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19186-19219 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19270-19303 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19426-19459 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19648-19681 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490056-490089 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490350-490383 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804198-804231 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804280-804313 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804580-804613 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804646-804679 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804658-804691 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805030-805063 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805042-805075 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805234-805267 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805288-805321 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805504-805537 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458458-458491 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233518-233551 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233530-233563 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233668-233701 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320451-320484 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320457-320490 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320463-320496 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320469-320502 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320475-320508 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320481-320514 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320487-320520 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320493-320526 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741209-1741242 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741215-1741248 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741221-1741254 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741227-1741260 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741233-1741266 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741239-1741272 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741245-1741278 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741251-1741284 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741257-1741290 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93605-93638 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93611-93644 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93617-93650 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93623-93656 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93629-93662 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798684-1798717 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798690-1798723 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798696-1798729 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141134-1141167 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141140-1141173 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141146-1141179 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141152-1141185 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141158-1141191 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141164-1141197 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141170-1141203 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590093-590126 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590826-590859 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972464-1972497 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972470-1972503 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972476-1972509 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972482-1972515 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972488-1972521 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972494-1972527 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972500-1972533 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972506-1972539 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972512-1972545 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972518-1972551 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972524-1972557 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451010-1451043 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451016-1451049 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451022-1451055 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451028-1451061 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451034-1451067 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451040-1451073 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451046-1451079 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566024-566057 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566030-566063 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566036-566069 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566042-566075 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566048-566081 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566054-566087 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566060-566093 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566066-566099 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808180-1808213 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668808-668841 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668814-668847 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668820-668853 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668826-668859 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668832-668865 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668838-668871 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748469-1748502 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748475-1748508 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748481-1748514 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748487-1748520 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748493-1748526 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748499-1748532 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748505-1748538 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748511-1748544 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743290-1743323 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743296-1743329 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743302-1743335 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743308-1743341 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743314-1743347 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743320-1743353 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743326-1743359 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743332-1743365 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743338-1743371 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743344-1743377 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743350-1743383 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743356-1743389 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743362-1743395 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743368-1743401 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743374-1743407 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743380-1743413 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814112-1814145 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814118-1814151 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814124-1814157 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814130-1814163 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814136-1814169 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814142-1814175 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814148-1814181 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686286-1686319 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686292-1686325 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686298-1686331 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686304-1686337 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686310-1686343 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686316-1686349 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686322-1686355 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686328-1686361 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686334-1686367 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686340-1686373 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686346-1686379 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744743-1744776 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744749-1744782 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819660-1819693 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814079-1814112 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814085-1814118 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814091-1814124 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814097-1814130 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814103-1814136 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814109-1814142 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814115-1814148 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721563-1721596 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721569-1721602 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721575-1721608 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721581-1721614 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721587-1721620 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721593-1721626 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812822-1812855 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812828-1812861 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812834-1812867 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812840-1812873 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812846-1812879 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812852-1812885 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812858-1812891 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708033-1708066 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708039-1708072 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708045-1708078 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708051-1708084 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708057-1708090 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721875-1721908 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721881-1721914 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721887-1721920 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721893-1721926 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721899-1721932 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721905-1721938 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812921-1812954 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812927-1812960 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812933-1812966 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812939-1812972 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812945-1812978 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812951-1812984 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812957-1812990 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721563-1721596 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721569-1721602 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721575-1721608 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721581-1721614 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721587-1721620 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721593-1721626 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708680-1708713 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708686-1708719 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708692-1708725 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708698-1708731 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708704-1708737 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720766-1720799 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720772-1720805 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720778-1720811 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720784-1720817 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720790-1720823 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720796-1720829 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812917-1812950 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812923-1812956 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812929-1812962 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812935-1812968 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812941-1812974 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812947-1812980 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812953-1812986 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812906-1812939 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812912-1812945 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812918-1812951 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812924-1812957 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812930-1812963 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812936-1812969 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812942-1812975 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708056-1708089 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708062-1708095 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708068-1708101 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708074-1708107 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708080-1708113 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812906-1812939 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812912-1812945 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812918-1812951 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812924-1812957 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812930-1812963 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812936-1812969 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812942-1812975 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708056-1708089 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708062-1708095 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708068-1708101 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708074-1708107 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708080-1708113 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721874-1721907 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721880-1721913 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721886-1721919 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721892-1721925 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721898-1721931 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721904-1721937 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813903-1813936 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813909-1813942 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813915-1813948 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813921-1813954 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813927-1813960 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813933-1813966 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813939-1813972 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708056-1708089 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708062-1708095 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708068-1708101 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708074-1708107 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708080-1708113 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708056-1708089 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708062-1708095 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708068-1708101 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708074-1708107 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708080-1708113 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812917-1812950 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812923-1812956 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812929-1812962 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812935-1812968 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812941-1812974 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812947-1812980 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812953-1812986 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812928-1812961 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812934-1812967 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812940-1812973 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812946-1812979 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812952-1812985 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812958-1812991 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812964-1812997 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812729-1812762 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812735-1812768 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812741-1812774 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812747-1812780 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812753-1812786 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812759-1812792 3 0.912
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812765-1812798 3 0.912
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108192-108219 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108246-108273 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108367-108394 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108379-108406 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108391-108418 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108403-108430 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79386-79413 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79506-79533 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79722-79749 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79734-79761 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79746-79773 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79758-79785 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79878-79905 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79932-79959 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28768-28795 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30256-30283 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 249031-249058 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 249043-249070 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 249055-249082 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 249067-249094 3 0.893
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491406-491433 3 0.893
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458422-458455 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233566-233599 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140556-140589 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142098-142131 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165173-165206 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166712-166745 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19792-19825 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590305-590338 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590378-590411 3 0.912
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490722-490755 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533775-533808 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533799-533832 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533823-533856 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534309-534342 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804568-804601 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804592-804625 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804616-804649 3 0.912
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805102-805135 3 0.912
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534516-534543 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533967-533994 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534474-534501 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805474-805501 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804760-804787 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805432-805459 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590117-590144 3 0.893
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590348-590375 3 0.893
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805276-805303 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590844-590871 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590784-590811 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18814-18841 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18856-18883 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19060-19087 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533397-533424 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533685-533712 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533925-533952 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534207-534234 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804108-804135 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804190-804217 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804478-804505 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804718-804745 3 0.893
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805000-805027 3 0.893
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1270879-1270900 3 0.864
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP023721 Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence 215598-215619 3 0.864
NZ_CP042930_3 3.50|3325230|22|NZ_CP042930|CRT 3325230-3325251 22 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 346231-346252 3 0.864
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19204-19231 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19276-19303 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18916-18943 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19582-19609 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19696-19723 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19972-19999 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490158-490185 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490824-490851 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490860-490887 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490884-490911 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534540-534567 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534225-534252 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590820-590847 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805270-805297 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805498-805525 4 0.857
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805018-805045 4 0.857
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19378-19411 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802321-1802354 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164311-164344 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2020-2053 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2985-3018 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791679-791712 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165763-165796 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458578-458611 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124390-124423 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124396-124429 4 0.882
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 648420-648453 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20434-20467 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491274-491307 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491520-491553 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 82137-82170 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 81656-81689 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 26233-26266 4 0.882
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 78294-78327 4 0.882
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18928-18955 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18970-18997 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19024-19051 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19120-19147 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19318-19345 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19510-19537 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19600-19627 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19654-19681 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20104-20131 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20230-20257 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533679-533706 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533997-534024 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534033-534060 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534255-534282 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534345-534372 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534414-534441 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534438-534465 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534564-534591 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534678-534705 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804472-804499 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804790-804817 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804826-804853 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805048-805075 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805138-805165 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805198-805225 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805306-805333 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805372-805399 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805396-805423 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805510-805537 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805624-805651 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143606-143633 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802321-1802348 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132883-132910 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139554-139581 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167719-167746 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124390-124417 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26477-26504 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26483-26510 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26478-26505 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590111-590138 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233398-233425 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233524-233551 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113205-113232 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490062-490089 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490086-490113 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490356-490383 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491118-491145 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491262-491289 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491310-491337 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491424-491451 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215951-215978 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP040758 Paracoccus sp. 2251 plasmid unnamed7, complete sequence 13056-13083 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 238278-238305 4 0.857
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 56932-56959 4 0.857
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19786-19819 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19882-19915 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533775-533808 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533799-533832 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533823-533856 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804568-804601 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804592-804625 4 0.882
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804616-804649 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533763-533796 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18886-18919 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18964-18997 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19174-19207 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19198-19231 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19246-19279 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19312-19345 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19978-20011 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804556-804589 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458722-458755 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233644-233677 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320499-320532 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741203-1741236 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93635-93668 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798678-1798711 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972458-1972491 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451004-1451037 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566072-566105 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808174-1808207 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668844-668877 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748463-1748496 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743284-1743317 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814106-1814139 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686280-1686313 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744737-1744770 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819654-1819687 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814073-1814106 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721557-1721590 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812816-1812849 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708027-1708060 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721869-1721902 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812915-1812948 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721557-1721590 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708674-1708707 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720760-1720793 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812911-1812944 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812900-1812933 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708050-1708083 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812900-1812933 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708050-1708083 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721868-1721901 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813897-1813930 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708050-1708083 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708050-1708083 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812911-1812944 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812922-1812955 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812723-1812756 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378037-378070 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378043-378076 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828201-1828234 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799095-1799128 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799095-1799128 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799095-1799128 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799095-1799128 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799095-1799128 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797411-1797444 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796410-1796443 4 0.882
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799100-1799133 4 0.882
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108120-108147 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79398-79425 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79518-79545 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79668-79695 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80004-80031 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30070-30097 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30334-30361 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 249079-249106 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132919-132946 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133039-133066 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133123-133150 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139740-139767 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141276-141303 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166000-166027 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167533-167560 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19114-19141 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19504-19531 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 459046-459073 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590159-590186 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590171-590198 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MH067975 Arthrobacter sp. strain ANT_H58 plasmid pA58H2, complete sequence 51084-51111 4 0.857
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 312335-312362 4 0.857
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458314-458347 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139950-139983 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140286-140319 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140952-140985 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141486-141519 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141828-141861 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142494-142527 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142836-142869 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164436-164469 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164778-164811 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165442-165475 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165784-165817 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166318-166351 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166982-167015 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167318-167351 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19036-19069 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19996-20029 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20140-20173 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533805-533838 4 0.882
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804598-804631 4 0.882
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534420-534447 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533649-533676 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533877-533904 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534261-534288 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534351-534378 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805192-805219 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805312-805339 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805378-805405 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804442-804469 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804670-804697 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805054-805081 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805144-805171 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140346-140373 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141888-141915 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142896-142923 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164382-164409 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165388-165415 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166928-166955 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133489-133516 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108174-108201 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79950-79977 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79272-79299 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20260-20287 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19648-19675 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19804-19831 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19210-19237 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19480-19507 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19702-19729 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20284-20311 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20326-20353 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590299-590326 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590372-590399 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590275-590302 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590317-590344 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590390-590417 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590502-590529 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590147-590174 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490092-490119 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490320-490347 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490536-490563 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490614-490641 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490692-490719 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490752-490779 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490794-490821 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491040-491067 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491088-491115 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491382-491409 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 144247-144274 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458152-458179 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458212-458239 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458284-458311 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458734-458761 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458866-458893 4 0.857
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458470-458497 4 0.857
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791721-791748 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590211-590238 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19216-19243 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19456-19483 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19840-19867 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20392-20419 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534420-534447 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534768-534795 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804270-804297 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805312-805339 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805378-805405 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805714-805741 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491040-491067 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458242-458269 4 0.857
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458512-458539 4 0.857
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 2092805-2092832 4 0.857
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20284-20317 4 0.882
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590147-590180 4 0.882
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2649-2688 4 0.9
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2655-2694 4 0.9
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2661-2700 4 0.9
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2667-2706 4 0.9
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2673-2712 4 0.9
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2679-2718 4 0.9
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2685-2724 4 0.9
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29260-29287 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29356-29383 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18898-18925 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19060-19087 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19258-19285 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19360-19387 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19930-19957 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534063-534090 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533685-533712 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533925-533952 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534207-534234 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458734-458761 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458866-458893 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458392-458419 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490242-490269 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491022-491049 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804856-804883 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804478-804505 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804718-804745 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805000-805027 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590093-590120 4 0.857
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590784-590811 4 0.857
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 CP003676 Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence 2897-2930 5 0.853
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18844-18871 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18928-18955 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19024-19051 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19642-19669 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19948-19975 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18874-18901 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19234-19261 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19348-19375 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490992-491019 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491064-491091 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491340-491367 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490008-490035 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490050-490077 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490866-490893 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490926-490953 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533961-533988 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534756-534783 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533703-533730 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534345-534372 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534708-534735 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533643-533670 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533901-533928 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590087-590114 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590772-590799 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590862-590889 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233674-233701 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804258-804285 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804754-804781 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805702-805729 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804496-804523 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805138-805165 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805330-805357 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805654-805681 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804436-804463 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804694-804721 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 MK359329 Mycobacterium phage Kamryn, complete genome 156129-156156 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 MK359329 Mycobacterium phage Kamryn, complete genome 156141-156168 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140682-140709 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142224-142251 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165053-165080 5 0.821
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166592-166619 5 0.821
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113205-113238 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143606-143639 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26471-26504 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26477-26510 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26472-26505 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2008-2041 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2997-3030 5 0.853
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165757-165790 5 0.853
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 MN582058 Caudovirales sp. ctOwN3, complete genome 17298-17331 5 0.853
NZ_CP042930_3 3.15|3323154|46|NZ_CP042930|CRT 3323154-3323199 46 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458728-458773 5 0.891
NZ_CP042930_3 3.15|3323154|46|NZ_CP042930|CRT 3323154-3323199 46 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458860-458905 5 0.891
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165757-165784 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802339-1802366 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720561-720588 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2008-2035 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 3003-3030 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 17239-17266 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467923-1467950 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453484-1453511 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720520-720547 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376255-376282 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720371-720398 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720349-720376 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215945-215972 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141182-1141209 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 409958-409985 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 318709-318736 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 625235-625262 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP018857 Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence 16363-16390 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP018857 Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence 16369-16396 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1176524-1176551 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP017579 Sphingomonas melonis TY plasmid unnamed, complete sequence 4652-4679 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP017579 Sphingomonas melonis TY plasmid unnamed, complete sequence 35740-35767 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP015734 Arthrobacter sp. U41 plasmid unnamed2, complete sequence 113617-113644 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 110490-110517 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 161813-161840 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_009936 Pseudomonas phage LKA1, complete genome 25576-25603 5 0.821
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 AM265639 Pseudomonas phage LKA1 complete genome, specific host Pseudomonas aeruginosa 25576-25603 5 0.821
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19564-19597 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20074-20107 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534309-534342 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534105-534138 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805102-805135 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804898-804931 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233680-233713 5 0.853
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490908-490941 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233392-233425 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590241-590274 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143606-143639 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802321-1802354 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165316-165349 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124390-124423 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215945-215978 5 0.853
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 86314-86347 5 0.853
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29032-29059 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28498-28525 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28828-28855 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30712-30739 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133051-133078 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133285-133312 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133423-133450 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133777-133804 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 634153-634180 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 634154-634181 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 632594-632621 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 636841-636868 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 623713-623740 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 634154-634181 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 723964-723991 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 20222-20249 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 341373-341400 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 773710-773737 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 773775-773802 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 773775-773802 5 0.821
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 773760-773787 5 0.821
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590868-590901 5 0.853
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533685-533712 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533925-533952 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534207-534234 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533841-533868 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534327-534354 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534630-534657 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533775-533802 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533799-533826 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533853-533880 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533865-533892 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533907-533934 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534039-534066 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534444-534471 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534546-534573 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804478-804505 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804718-804745 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805000-805027 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804634-804661 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805120-805147 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805210-805237 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805576-805603 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804568-804595 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804592-804619 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804646-804673 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804658-804685 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804700-804727 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804832-804859 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805402-805429 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139578-139605 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140010-140037 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140070-140097 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141012-141039 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141078-141105 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141546-141573 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141612-141639 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142554-142581 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142620-142647 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164658-164685 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164724-164751 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165664-165691 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165730-165757 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166198-166225 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166264-166291 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167204-167231 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167264-167291 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167695-167722 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132907-132934 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132937-132964 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132961-132988 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107880-107907 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107916-107943 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107988-108015 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108024-108051 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108210-108237 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79224-79251 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79914-79941 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80100-80127 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80136-80163 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80208-80235 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80244-80271 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18898-18925 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19060-19087 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19258-19285 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19456-19483 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19090-19117 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19396-19423 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19594-19621 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19678-19705 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19834-19861 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20164-20191 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18880-18907 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18934-18961 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19030-19057 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19240-19267 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19282-19309 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19606-19633 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20110-20137 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20134-20161 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20224-20251 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590784-590811 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590550-590577 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590754-590781 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490938-490965 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490272-490299 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490392-490419 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490434-490461 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490836-490863 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490974-491001 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491268-491295 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490056-490083 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490068-490095 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490362-490389 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490806-490833 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491070-491097 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491178-491205 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491304-491331 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491418-491445 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458044-458071 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458494-458521 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458548-458575 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458854-458881 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233404-233431 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233470-233497 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233530-233557 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233542-233569 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233656-233683 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233680-233707 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 MK977696 Gordonia phage SCentae, complete genome 110683-110710 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 MK977695 Gordonia phage Pupper, complete genome 110529-110556 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5177489-5177516 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 648854-648881 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 CP003676 Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence 2903-2930 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 LR606150 Rhizobium sp. Q54 genome assembly, plasmid: 7 94231-94258 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 99095-99122 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 113531-113558 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 212012-212039 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 824683-824710 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1956063-1956090 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 102504-102531 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 291150-291177 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1390699-1390726 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 103751-103778 5 0.821
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 284357-284384 5 0.821
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804496-804523 5 0.821
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533703-533730 5 0.821
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458368-458395 5 0.821
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458260-458287 5 0.821
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233674-233701 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590117-590144 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590694-590721 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590700-590727 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590754-590781 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18934-18961 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19030-19057 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19096-19123 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19186-19213 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19282-19309 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19486-19513 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19606-19633 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19990-20017 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20044-20071 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20110-20137 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20134-20161 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20200-20227 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534474-534501 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533439-533466 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534444-534471 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534522-534549 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534690-534717 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534714-534741 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804150-804177 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805432-805459 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804232-804259 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805288-805315 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805336-805363 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805402-805429 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805480-805507 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805636-805663 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805660-805687 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490482-490509 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490014-490041 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490170-490197 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490806-490833 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491070-491097 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491076-491103 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491154-491181 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491178-491205 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491352-491379 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491388-491415 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458140-458167 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458272-458299 5 0.821
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233626-233653 5 0.821
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NZ_CP017756 Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence 150628-150655 5 0.821
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 76373-76400 5 0.821
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 124709-124736 5 0.821
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132901-132940 5 0.875
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590177-590216 5 0.875
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458356-458395 5 0.875
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19732-19759 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19834-19861 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20386-20413 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18880-18907 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18934-18961 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19030-19057 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19186-19213 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19240-19267 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19282-19309 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19384-19411 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19456-19483 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19564-19591 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19648-19675 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19786-19813 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19882-19909 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19990-20017 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20134-20161 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20392-20419 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534762-534789 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533823-533850 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533907-533934 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534039-534066 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534105-534132 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534420-534447 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534444-534471 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534768-534795 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458470-458497 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 459022-459049 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458056-458083 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458644-458671 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458668-458695 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458818-458845 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166054-166081 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141222-141249 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165167-165194 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165191-165218 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166706-166733 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166730-166757 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140544-140571 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140568-140595 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142086-142113 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142110-142137 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80100-80127 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80136-80163 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80208-80235 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80244-80271 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107880-107907 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107916-107943 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107988-108015 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108024-108051 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79698-79725 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108427-108454 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79152-79179 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79248-79275 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79950-79977 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108174-108201 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491268-491295 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490092-490119 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490164-490191 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490362-490389 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490434-490461 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490938-490965 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490974-491001 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490998-491025 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491040-491067 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491070-491097 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491202-491229 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491352-491379 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491388-491415 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805708-805735 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804616-804643 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804700-804727 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804832-804859 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804898-804925 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805312-805339 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805354-805381 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805378-805405 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805402-805429 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805714-805741 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791673-791700 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791751-791778 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 MN369757 Streptomyces phage Bordeaux, complete genome 49710-49737 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 MN484599 Streptomyces phage Wipeout, complete genome 49926-49953 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 MK801722 Streptomyces phage Birchlyn, complete genome 47438-47465 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 MN369750 Streptomyces phage TomSawyer, complete genome 49175-49202 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 MH576964 Streptomyces phage Starbow, complete genome 49557-49584 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590826-590853 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590844-590871 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804264-804291 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804270-804297 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233680-233707 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4663543-4663570 5 0.821
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 CP003676 Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence 2903-2930 5 0.821
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 688133-688164 5 0.844
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20410-20443 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19840-19873 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20332-20365 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20278-20311 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490926-490959 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491118-491151 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791673-791706 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108288-108321 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79536-79569 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79830-79863 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533517-533550 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533997-534030 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534309-534342 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534564-534597 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533703-533736 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534225-534258 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590718-590751 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804228-804261 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804310-804343 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804790-804823 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805102-805135 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805510-805543 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804496-804529 6 0.824
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805018-805051 6 0.824
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18952-18979 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19048-19075 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19300-19327 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19444-19471 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20008-20035 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20152-20179 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490086-490113 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490230-490257 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490356-490383 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490716-490743 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534033-534060 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534255-534282 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590229-590256 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233440-233467 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233488-233515 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804826-804853 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805048-805075 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805276-805303 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791721-791748 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140760-140787 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142302-142329 6 0.786
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164975-165002 6 0.786
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720561-720594 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802333-1802366 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141168-141201 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166102-166135 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26441-26474 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26441-26474 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26442-26475 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590183-590216 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 161425-161458 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720520-720553 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467917-1467950 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376255-376288 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720371-720404 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720349-720382 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453478-1453511 6 0.824
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1657467-1657500 6 0.824
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 MN582058 Caudovirales sp. ctOwN3, complete genome 17274-17307 6 0.824
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 MH518298 Pseudomonas phage SCYZ1, complete genome 41777-41810 6 0.824
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720573-720600 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590436-590463 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590247-590274 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 867879-867906 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467911-1467938 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 218417-218444 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453472-1453499 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 218140-218167 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1802185-1802212 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720532-720559 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 130313-130340 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376267-376294 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1801853-1801880 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720383-720410 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1801797-1801824 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720361-720388 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_MF600313 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence 133585-133612 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171832-171859 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 669320-669347 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 243122-243149 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 166015-166042 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 173425-173452 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP039925 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence 206496-206523 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 138066-138093 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP035035 Pantoea ananatis strain NN08200 plasmid unnamed1, complete sequence 86121-86148 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1007691-1007718 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1007684-1007711 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1007698-1007725 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP054024 Rhizobium sp. JKLM12A2 plasmid pPR12A203, complete sequence 301542-301569 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 802928-802955 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 936600-936627 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 MN693976 Marine virus AFVG_250M247, complete genome 33570-33597 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 648432-648459 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP049734 Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence 234755-234782 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP049734 Rhizobium leguminosarum strain A1 plasmid pRLa11, complete sequence 23487-23514 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 280226-280253 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 354260-354287 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP054035 Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence 189367-189394 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 CP054910 Pantoea ananatis strain FDAARGOS_680 plasmid unnamed2, complete sequence 5148-5175 6 0.786
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP045322 Roseivivax sp. THAF197b plasmid pTHAF197b_d, complete sequence 30255-30282 6 0.786
NZ_CP042930_3 3.17|3323268|40|NZ_CP042930|CRT 3323268-3323307 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133855-133894 6 0.85
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18886-18919 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19246-19279 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19948-19981 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533517-533550 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534708-534741 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804310-804343 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805330-805363 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805654-805687 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 CP003676 Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence 2897-2930 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458308-458341 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 459022-459055 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233530-233563 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79194-79227 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79974-80007 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108144-108177 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490260-490293 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490110-490143 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804228-804261 6 0.824
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590862-590895 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798702-1798735 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590183-590216 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590430-590463 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451052-1451085 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808186-1808219 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814154-1814187 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819666-1819699 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814121-1814154 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812864-1812897 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812963-1812996 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812959-1812992 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812948-1812981 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812948-1812981 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813945-1813978 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812959-1812992 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812970-1813003 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812771-1812804 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828207-1828240 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799101-1799134 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799101-1799134 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799101-1799134 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799101-1799134 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799101-1799134 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797417-1797450 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796416-1796449 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799106-1799139 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2008-2041 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2997-3030 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165757-165790 6 0.824
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 166015-166048 6 0.824
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28462-28489 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133501-133528 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133633-133660 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140292-140319 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140430-140457 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141834-141861 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141972-141999 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142842-142869 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142980-143007 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164299-164326 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164436-164463 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165442-165469 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166844-166871 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166982-167009 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590183-590210 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_007949 Polaromonas sp. JS666 plasmid 1, complete sequence 31352-31379 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP025614 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed2, complete sequence 99213-99240 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1196606-1196633 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 353465-353492 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 215279-215306 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 218978-219005 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 1891-1918 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 923782-923809 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1569971-1569998 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 4266-4293 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 11167-11194 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP016454 Sphingobium sp. RAC03 plasmid pBSY17_4, complete sequence 16073-16100 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP016454 Sphingobium sp. RAC03 plasmid pBSY17_4, complete sequence 22974-23001 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MN369749 Mycobacterium phage MinionDave, complete genome 32456-32483 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MH632118 Mycobacterium phage Zeeculate, complete genome 52124-52151 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MT684593 Mycobacterium phage Moonbeam, complete genome 31973-32000 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MF919508 Mycobacterium phage ILeeKay, complete genome 49271-49298 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 JN153085 Mycobacterium phage Doom, complete genome 49275-49302 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MF431615 Lentibacter virus vB_LenP_VB3, complete genome 2441-2468 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_023695 Mycobacterium phage Violet, complete genome 49958-49985 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 KM652553 Mycobacterium phage CaptainTrips, complete genome 31681-31708 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MH825707 Mycobacterium phage MilleniumForce, complete genome 32219-32246 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1466829-1466856 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1545297-1545324 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 542120-542147 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1984500-1984527 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1473128-1473155 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1503888-1503915 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1469858-1469885 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1469387-1469414 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1557291-1557318 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1460358-1460385 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1557291-1557318 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1461004-1461031 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1557291-1557318 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1557291-1557318 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1557291-1557318 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1460380-1460407 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171820-171847 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1554606-1554633 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1460380-1460407 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1561096-1561123 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1460380-1460407 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1460380-1460407 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1557294-1557321 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NC_048672 Lentibacter virus vB_LenP_ICBM1, complete genome 37697-37724 6 0.786
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 MF431617 Lentibacter virus vB_LenP_VB1, complete genome 37697-37724 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534237-534264 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534690-534717 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805030-805057 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805288-805315 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805636-805663 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140196-140223 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141738-141765 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142746-142773 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164532-164559 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165538-165565 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167078-167105 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19186-19213 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19360-19387 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19930-19957 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19990-20017 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20020-20047 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20302-20329 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20392-20419 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590093-590120 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590241-590268 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590580-590607 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590844-590871 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491352-491379 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 110496-110523 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458416-458443 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458596-458623 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233392-233419 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 233644-233671 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1282770-1282797 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 164896-164923 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 648426-648453 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1136879-1136906 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 863855-863882 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 285636-285663 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 81369-81396 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 870082-870109 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 57885-57912 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 79283-79310 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1119068-1119095 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 409952-409979 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 651558-651585 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 530947-530974 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 629538-629565 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 13862-13889 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 45713-45740 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1321670-1321697 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP034087 Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence 217588-217615 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 787515-787542 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 167819-167846 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 167819-167846 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1776732-1776759 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 289106-289133 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1801769-1801796 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1834284-1834311 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1561291-1561318 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1862157-1862184 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1799403-1799430 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 2006401-2006428 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1487836-1487863 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1767062-1767089 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 376406-376433 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 740048-740075 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1843768-1843795 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1552538-1552565 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1784022-1784049 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1781838-1781865 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1778892-1778919 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1850938-1850965 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1720223-1720250 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1780253-1780280 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1855248-1855275 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1850905-1850932 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1757184-1757211 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1834683-1834710 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1849648-1849675 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1747333-1747360 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1757496-1757523 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1834683-1834710 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1849747-1849774 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1757184-1757211 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1747980-1748007 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1756387-1756414 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1834683-1834710 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1834683-1834710 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1834683-1834710 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1849743-1849770 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1907099-1907126 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1849732-1849759 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1747356-1747383 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1760480-1760507 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1741119-1741146 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1801011-1801038 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1832999-1833026 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1831998-1832025 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1849732-1849759 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1747356-1747383 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1757495-1757522 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1770524-1770551 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1850729-1850756 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1747356-1747383 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1747356-1747383 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1849743-1849770 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1834688-1834715 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1849754-1849781 6 0.786
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1849555-1849582 6 0.786
NZ_CP042930_3 3.34|3324306|28|NZ_CP042930|CRT 3324306-3324333 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458494-458521 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590147-590174 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590508-590535 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19090-19117 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19210-19237 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19480-19507 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20284-20311 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20434-20461 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534315-534342 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805108-805135 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805252-805279 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490836-490863 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491268-491295 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491274-491301 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_AP022320 Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence 72665-72692 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 169979-170006 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79272-79299 6 0.786
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79374-79401 6 0.786
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 MK919474 Microbacterium phage Lupine, complete genome 28162-28189 6 0.786
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 140426-140453 6 0.786
NZ_CP042930_3 3.37|3324444|28|NZ_CP042930|CRT 3324444-3324471 28 NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 694685-694712 6 0.786
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458452-458491 6 0.85
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132913-132952 6 0.85
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491256-491295 6 0.85
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19090-19117 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19210-19237 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19450-19477 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19480-19507 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19600-19627 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533433-533460 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533709-533736 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533967-533994 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534003-534030 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534075-534102 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534261-534288 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534351-534378 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534474-534501 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534570-534597 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534684-534711 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458260-458287 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458542-458569 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458548-458575 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79374-79401 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490830-490857 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491124-491151 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491274-491301 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491346-491373 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491382-491409 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804226-804253 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804502-804529 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804760-804787 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804796-804823 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804868-804895 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805054-805081 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805144-805171 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805282-805309 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805432-805459 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805516-805543 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805630-805657 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791715-791742 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590117-590144 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590688-590715 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590694-590721 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590838-590865 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804144-804171 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP017294 Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence 44148-44175 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 940854-940881 6 0.786
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 CP003674 Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence 19-46 6 0.786
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 187746-187777 6 0.812
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 MG969407 UNVERIFIED: Salmonella phage GE_vB_BS, complete genome 29709-29740 6 0.812
NZ_CP042930_6 6.12|3729642|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729642-3729673 32 KY653119 Morganella phage IME1369_02, complete genome 9148-9179 6 0.812
NZ_CP042930_6 6.31|3730797|32|NZ_CP042930|PILER-CR 3730797-3730828 32 NZ_LT883141 Escherichia coli isolate 6666666.257727.embl plasmid III 85081-85112 6 0.812
NZ_CP042930_6 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder 3730784-3730815 32 NZ_LT883141 Escherichia coli isolate 6666666.257727.embl plasmid III 85081-85112 6 0.812
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19708-19741 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20074-20107 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19726-19759 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20260-20293 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 133015-133048 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 139914-139947 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140172-140205 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140916-140949 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141450-141483 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141714-141747 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142458-142491 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142722-142755 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164550-164583 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164814-164847 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165556-165589 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165820-165853 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 166354-166387 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167096-167129 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167354-167387 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458134-458167 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490908-490941 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491172-491205 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108168-108201 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79950-79983 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534123-534156 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590141-590174 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590454-590487 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804916-804949 7 0.794
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 MH518298 Pseudomonas phage SCYZ1, complete genome 41771-41804 7 0.794
NZ_CP042930_3 3.9|3322830|28|NZ_CP042930|CRT 3322830-3322857 28 NZ_CP025015 Rhizobium leguminosarum strain Norway plasmid pRLN3, complete sequence 424710-424737 7 0.75
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113229-113262 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143600-143633 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720567-720600 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802315-1802348 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 17239-17272 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720526-720559 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467911-1467944 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376261-376294 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720377-720410 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720355-720388 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453472-1453505 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215945-215978 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 265299-265332 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 625047-625080 7 0.794
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 166009-166042 7 0.794
NZ_CP042930_3 3.14|3323100|34|NZ_CP042930|CRT 3323100-3323133 34 NZ_MF600313 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence 133585-133618 7 0.794
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26441-26468 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26441-26468 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26442-26469 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 161425-161452 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1657473-1657500 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 238272-238299 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 134429-134456 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 716138-716165 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1127250-1127277 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_LR134428 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 19 87118-87145 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 137619-137646 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP051182 Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence 67743-67770 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 MT188704 Mesorhizobium phage Cp1R7A-A1, complete genome 56780-56807 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 88976-89003 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 160104-160131 7 0.75
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP049117 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed2, complete sequence 98519-98546 7 0.75
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28540-28579 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28954-28993 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29110-29149 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29608-29647 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29734-29773 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29806-29845 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29926-29965 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30466-30505 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30538-30577 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 28918-28957 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29074-29113 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30196-30235 7 0.825
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30502-30541 7 0.825
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19090-19123 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19132-19165 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19396-19429 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19480-19513 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19522-19555 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20344-20377 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533913-533946 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534195-534228 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533967-534000 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534075-534108 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534357-534390 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534762-534795 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804706-804739 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804988-805021 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804760-804793 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804868-804901 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805150-805183 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805252-805285 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805708-805741 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458548-458581 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458812-458845 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 79482-79515 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80022-80055 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80070-80103 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 80178-80211 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 107940-107973 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108048-108081 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 108096-108129 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490716-490749 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804264-804297 7 0.794
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590772-590805 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378049-378082 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720567-720600 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 720555-720588 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26477-26510 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26483-26516 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26478-26511 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2026-2059 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2979-3012 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165769-165802 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124384-124417 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900309-900342 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720526-720559 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 720514-720547 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467911-1467944 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1467923-1467956 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376261-376294 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 376249-376282 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730602-1730635 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720377-720410 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 720365-720398 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720355-720388 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 720343-720376 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828203-1828236 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453472-1453505 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1453484-1453517 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765429-1765462 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215951-215984 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_KX868552 Klebsiella variicola strain H152460787 plasmid pJF-787, complete sequence 66425-66458 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_LC511995 Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence 91259-91292 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_LC511996 Enterobacter hormaechei subsp. xiangfangensis strain MY458 plasmid pMY458-rmtE, complete sequence 90668-90701 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_LC511997 Enterobacter hormaechei subsp. xiangfangensis strain MY460 plasmid pMY460-rmtE, complete sequence 218645-218678 7 0.794
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_MH325469 Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence 96568-96601 7 0.794
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP038792 Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence 49289-49316 7 0.75
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 511601-511628 7 0.75
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP023471 Salmonella enterica subsp. enterica strain BAA-1672 plasmid pSalSendai, complete sequence 75211-75238 7 0.75
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 NZ_CP012501 Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence 99879-99906 7 0.75
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 791655-791688 7 0.794
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 30394-30427 7 0.794
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1297508-1297541 7 0.794
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 73221-73254 7 0.794
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 173669-173702 7 0.794
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165316-165343 7 0.75
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_014957 Isosphaera pallida ATCC 43644 plasmid pISOP01, complete sequence 20760-20787 7 0.75
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 96169-96196 7 0.75
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 916464-916491 7 0.75
NZ_CP042930_3 3.31|3324168|28|NZ_CP042930|CRT 3324168-3324195 28 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 94619-94646 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 324955-324982 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 488835-488862 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 84195-84222 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 237500-237527 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 521695-521722 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 KC117377 Halovirus HVTV-1, complete genome 9901-9928 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 66897-66924 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 927692-927719 7 0.75
NZ_CP042930_3 3.35|3324354|28|NZ_CP042930|CRT 3324354-3324381 28 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 473152-473179 7 0.75
NZ_CP042930_3 3.42|3324708|40|NZ_CP042930|CRT 3324708-3324747 40 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491340-491379 7 0.825
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19438-19477 7 0.825
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590562-590601 7 0.825
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041098 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence 2691-2730 7 0.825
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458044-458071 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 177629-177656 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 98575-98602 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 358943-358970 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 144363-144390 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 419997-420024 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 447807-447834 7 0.75
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 350687-350714 7 0.75
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 628506-628537 7 0.781
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP009119 Borreliella valaisiana Tom4006 plasmid lp54, complete sequence 47710-47741 7 0.781
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 AJ630128 Bacteriophage S-PM2 complete genome 166955-166986 7 0.781
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 NC_006820 Synechococcus phage S-PM2, complete genome 166955-166986 7 0.781
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 LN828717 Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome 157411-157442 7 0.781
NZ_CP042930_6 6.25|3730430|33|NZ_CP042930|PILER-CR 3730430-3730462 33 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 385020-385052 7 0.788
NZ_CP042930_6 6.30|3730736|32|NZ_CP042930|PILER-CR 3730736-3730767 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1725644-1725675 7 0.781
NZ_CP042930_6 6.34|3730980|32|NZ_CP042930|PILER-CR 3730980-3731011 32 HQ634191 Cyanophage Syn10 genomic sequence 103758-103789 7 0.781
NZ_CP042930_6 6.34|3730980|32|NZ_CP042930|PILER-CR 3730980-3731011 32 KJ019027 Synechococcus phage ACG-2014c isolate Syn7803C43, complete genome 35919-35950 7 0.781
NZ_CP042930_6 6.34|3730980|32|NZ_CP042930|PILER-CR 3730980-3731011 32 DQ149023 Synechococcus cyanophage syn9, complete genome 46277-46308 7 0.781
NZ_CP042930_6 6.34|3730980|32|NZ_CP042930|PILER-CR 3730980-3731011 32 NC_019444 Synechococcus phage S-MbCM6, complete genome 35930-35961 7 0.781
NZ_CP042930_6 6.34|3730980|32|NZ_CP042930|PILER-CR 3730980-3731011 32 KJ019128 Synechococcus phage ACG-2014c isolate Syn7803US88, complete genome 35928-35959 7 0.781
NZ_CP042930_6 6.34|3730980|32|NZ_CP042930|PILER-CR 3730980-3731011 32 NC_008296 Synechococcus phage syn9, complete genome 46277-46308 7 0.781
NZ_CP042930_6 6.39|3731286|32|NZ_CP042930|PILER-CR 3731286-3731317 32 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 39291-39322 7 0.781
NZ_CP042930_6 6.41|3731408|32|NZ_CP042930|PILER-CR 3731408-3731439 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 25485-25516 7 0.781
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 AJ630128 Bacteriophage S-PM2 complete genome 166955-166986 7 0.781
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 NC_006820 Synechococcus phage S-PM2, complete genome 166955-166986 7 0.781
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 LN828717 Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome 157411-157442 7 0.781
NZ_CP042930_6 6.49|3730417|33|NZ_CP042930|CRT,CRISPRCasFinder 3730417-3730449 33 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 385020-385052 7 0.788
NZ_CP042930_6 6.54|3730723|32|NZ_CP042930|CRT,CRISPRCasFinder 3730723-3730754 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1725644-1725675 7 0.781
NZ_CP042930_6 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder 3730967-3730998 32 HQ634191 Cyanophage Syn10 genomic sequence 103758-103789 7 0.781
NZ_CP042930_6 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder 3730967-3730998 32 KJ019027 Synechococcus phage ACG-2014c isolate Syn7803C43, complete genome 35919-35950 7 0.781
NZ_CP042930_6 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder 3730967-3730998 32 DQ149023 Synechococcus cyanophage syn9, complete genome 46277-46308 7 0.781
NZ_CP042930_6 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder 3730967-3730998 32 NC_019444 Synechococcus phage S-MbCM6, complete genome 35930-35961 7 0.781
NZ_CP042930_6 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder 3730967-3730998 32 KJ019128 Synechococcus phage ACG-2014c isolate Syn7803US88, complete genome 35928-35959 7 0.781
NZ_CP042930_6 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder 3730967-3730998 32 NC_008296 Synechococcus phage syn9, complete genome 46277-46308 7 0.781
NZ_CP042930_6 6.63|3731273|32|NZ_CP042930|CRT,CRISPRCasFinder 3731273-3731304 32 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 39291-39322 7 0.781
NZ_CP042930_6 6.65|3731395|32|NZ_CP042930|CRT,CRISPRCasFinder 3731395-3731426 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 25485-25516 7 0.781
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19000-19033 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 458434-458467 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490008-490041 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490416-490449 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533493-533526 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 534285-534318 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804204-804237 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804286-804319 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805078-805111 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 MN694320 Marine virus AFVG_250M198, complete genome 979-1012 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NC_047962 Xanthomonas phage Carpasina, complete genome 55954-55987 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 MF754113 Vibrio phage vB_VpaS_KF3, complete genome 74168-74201 8 0.765
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 MF754114 Vibrio phage vB_VpaS_KF4, complete genome 19572-19605 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 143136-143169 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164137-164170 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26477-26510 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26483-26516 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26478-26511 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_008760 Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence 124384-124417 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215939-215972 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP017423 Arthrobacter sp. ZXY-2 plasmid pZXY22, complete sequence 16909-16942 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 329094-329127 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 MN657133 Cryobacterium sp. strain ANT_H10B plasmid pA10BH1, complete sequence 25143-25176 8 0.765
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 419499-419532 8 0.765
NZ_CP042930_3 3.14|3323100|34|NZ_CP042930|CRT 3323100-3323133 34 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 110490-110523 8 0.765
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113235-113262 8 0.714
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 NZ_CP040761 Paracoccus sp. 2251 plasmid unnamed5, complete sequence 121502-121529 8 0.714
NZ_CP042930_3 3.24|3323784|40|NZ_CP042930|CRT 3323784-3323823 40 NZ_CP022055 Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence 29698-29737 8 0.8
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19048-19081 8 0.765
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19444-19477 8 0.765
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20008-20041 8 0.765
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 20152-20185 8 0.765
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 491214-491247 8 0.765
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590229-590262 8 0.765
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590568-590601 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113199-113232 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 26441-26474 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 26441-26474 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 26442-26475 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171832-171865 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 161425-161458 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1657467-1657500 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 215939-215972 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 802928-802961 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 66931-66964 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 325146-325179 8 0.765
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 325145-325178 8 0.765
NZ_CP042930_3 3.28|3324012|28|NZ_CP042930|CRT 3324012-3324039 28 CP003674 Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence 1-22 8 0.714
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1803226-1803259 8 0.765
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 140190-140229 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 141732-141771 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 142740-142779 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 164526-164565 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 165532-165571 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 167072-167111 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 132871-132910 8 0.8
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171814-171853 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 533481-533520 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 804274-804313 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 805360-805399 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19714-19753 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 18964-19003 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 19312-19351 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590442-590481 8 0.8
NZ_CP042930_3 3.43|3324768|40|NZ_CP042930|CRT 3324768-3324807 40 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 804192-804231 8 0.8
NZ_CP042930_3 3.49|3325182|28|NZ_CP042930|CRT 3325182-3325209 28 GU943040 Uncultured phage MedDCM-OCT-S09-C28 genomic sequence 2976-3003 8 0.714
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MK552105 Escherichia phage Jahat_MG145, complete genome 38023-38054 8 0.75
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_KX786187 Enterobacter cloacae strain N14-0444 plasmid pIMI-6, complete sequence 34127-34158 8 0.75
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_KT225520 Raoultella ornithinolytica strain RJ46C plasmid pRJ46C, complete sequence 155616-155647 8 0.75
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 KT780723 Uncultured bacterium plasmid pGA45, complete sequence 110193-110224 8 0.75
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 181032-181063 8 0.75
NZ_CP042930_6 6.4|3729152|32|NZ_CP042930|CRISPRCasFinder,CRT 3729152-3729183 32 NC_021536 Synechococcus phage S-IOM18 genomic sequence 101168-101199 8 0.75
NZ_CP042930_6 6.10|3729519|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729519-3729550 32 NZ_CP044217 Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence 112280-112311 8 0.75
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 MH791398 UNVERIFIED: Aeromonas phage Asswx_1, complete genome 38607-38638 8 0.75
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 MN871442 UNVERIFIED: Aeromonas phage Aszh-1, complete genome 218159-218190 8 0.75
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 MN871441 UNVERIFIED: Aeromonas phage AsSzw2, complete genome 123329-123360 8 0.75
NZ_CP042930_6 6.31|3730797|32|NZ_CP042930|PILER-CR 3730797-3730828 32 MT375524 Pelagibacter phage Gjalp EXVC02, partial genome 3386-3417 8 0.75
NZ_CP042930_6 6.31|3730797|32|NZ_CP042930|PILER-CR 3730797-3730828 32 MT375523 Pelagibacter phage Eyrgjafa EXV, complete genome 31499-31530 8 0.75
NZ_CP042930_6 6.32|3730858|32|NZ_CP042930|PILER-CR 3730858-3730889 32 NZ_CP028237 Lactobacillus plantarum strain SRCM101511 plasmid unnamed2, complete sequence 29997-30028 8 0.75
NZ_CP042930_6 6.33|3730919|32|NZ_CP042930|PILER-CR 3730919-3730950 32 KP282678 Sulfolobus monocaudavirus SMV4, complete genome 23474-23505 8 0.75
NZ_CP042930_6 6.33|3730919|32|NZ_CP042930|PILER-CR 3730919-3730950 32 NC_028865 Tsukamurella phage TIN2, complete genome 25739-25770 8 0.75
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 MH791398 UNVERIFIED: Aeromonas phage Asswx_1, complete genome 38607-38638 8 0.75
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 MN871442 UNVERIFIED: Aeromonas phage Aszh-1, complete genome 218159-218190 8 0.75
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 MN871441 UNVERIFIED: Aeromonas phage AsSzw2, complete genome 123329-123360 8 0.75
NZ_CP042930_6 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder 3730784-3730815 32 MT375524 Pelagibacter phage Gjalp EXVC02, partial genome 3386-3417 8 0.75
NZ_CP042930_6 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder 3730784-3730815 32 MT375523 Pelagibacter phage Eyrgjafa EXV, complete genome 31499-31530 8 0.75
NZ_CP042930_6 6.56|3730845|32|NZ_CP042930|CRT,CRISPRCasFinder 3730845-3730876 32 NZ_CP028237 Lactobacillus plantarum strain SRCM101511 plasmid unnamed2, complete sequence 29997-30028 8 0.75
NZ_CP042930_6 6.57|3730906|32|NZ_CP042930|CRT,CRISPRCasFinder 3730906-3730937 32 KP282678 Sulfolobus monocaudavirus SMV4, complete genome 23474-23505 8 0.75
NZ_CP042930_6 6.57|3730906|32|NZ_CP042930|CRT,CRISPRCasFinder 3730906-3730937 32 NC_028865 Tsukamurella phage TIN2, complete genome 25739-25770 8 0.75
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590436-590469 9 0.735
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 940854-940887 9 0.735
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 114905-114938 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2026-2059 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2979-3012 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165769-165802 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1264373-1264406 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1146747-1146780 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1423321-1423354 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2112025-2112058 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 266143-266176 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1404835-1404868 9 0.735
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 679724-679757 9 0.735
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_LT559121 Nonomuraea gerenzanensis isolate nono1 plasmid II, complete sequence 22322-22355 9 0.735
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 491785-491818 9 0.735
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 415672-415705 9 0.735
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 415672-415705 9 0.735
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 CP000664 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence 98822-98855 9 0.735
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 MK448808 Streptococcus phage Javan569, complete genome 17362-17389 9 0.679
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 MK448807 Streptococcus phage Javan567, complete genome 17359-17386 9 0.679
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 MK448991 Streptococcus phage Javan590, complete genome 17359-17386 9 0.679
NZ_CP042930_3 3.16|3323220|28|NZ_CP042930|CRT 3323220-3323247 28 MK448805 Streptococcus phage Javan563, complete genome 17358-17385 9 0.679
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 673175-673208 9 0.735
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1177098-1177131 9 0.735
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 304438-304471 9 0.735
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 173669-173702 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320445-320478 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 320505-320538 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741263-1741296 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1741197-1741230 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93599-93632 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 93641-93674 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798672-1798705 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1798708-1798741 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1141128-1141161 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972530-1972563 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1972452-1972485 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1450998-1451031 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1451058-1451091 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566018-566051 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 566078-566111 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808168-1808201 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1808192-1808225 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668802-668835 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 668850-668883 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748517-1748550 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1748457-1748490 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743386-1743419 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1743278-1743311 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814100-1814133 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1814160-1814193 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686352-1686385 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1686274-1686307 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744755-1744788 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1744731-1744764 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819648-1819681 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1819672-1819705 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814067-1814100 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1814127-1814160 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721599-1721632 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1721551-1721584 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812810-1812843 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1812870-1812903 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708063-1708096 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1708021-1708054 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721911-1721944 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1721863-1721896 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812909-1812942 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1812969-1813002 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721599-1721632 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1721551-1721584 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708710-1708743 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1708668-1708701 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720802-1720835 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1720754-1720787 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812905-1812938 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1812965-1812998 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812894-1812927 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1812954-1812987 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708086-1708119 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1708044-1708077 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812894-1812927 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1812954-1812987 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708086-1708119 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1708044-1708077 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721910-1721943 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1721862-1721895 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813891-1813924 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1813951-1813984 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708086-1708119 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1708044-1708077 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708086-1708119 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1708044-1708077 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812905-1812938 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1812965-1812998 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812916-1812949 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1812976-1813009 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812717-1812750 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1812777-1812810 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 378031-378064 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 143600-143633 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828195-1828228 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1828213-1828246 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802315-1802348 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 113229-113262 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799089-1799122 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1799107-1799140 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799089-1799122 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1799107-1799140 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799089-1799122 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1799107-1799140 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799089-1799122 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1799107-1799140 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799089-1799122 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1799107-1799140 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797405-1797438 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1797423-1797456 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796404-1796437 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1796422-1796455 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799094-1799127 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1799112-1799145 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900315-900348 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 900303-900336 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730596-1730629 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1730608-1730641 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828197-1828230 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1828209-1828242 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765423-1765456 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1765435-1765468 9 0.735
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 241305-241338 9 0.735
NZ_CP042930_3 3.29|3324060|34|NZ_CP042930|CRT 3324060-3324093 34 NZ_MF600313 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence 133579-133612 9 0.735
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 304438-304471 9 0.735
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 673175-673208 9 0.735
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1177098-1177131 9 0.735
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 436983-437016 9 0.735
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171826-171865 9 0.775
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 34787-34820 9 0.735
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 999463-999496 9 0.735
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 MN855676 Bacteriophage sp. isolate 104, complete genome 6028-6061 9 0.735
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 22030-22069 9 0.775
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 14601-14640 9 0.775
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 26840-26879 9 0.775
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 126590-126629 9 0.775
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 249075-249114 9 0.775
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP028270 Pediococcus pentosaceus strain SRCM102740 plasmid unnamed1, complete sequence 13457-13488 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP028267 Pediococcus pentosaceus strain SRCM102739 plasmid unnamed1, complete sequence 163-194 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 1896-1927 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP028265 Pediococcus pentosaceus strain SRCM102738 plasmid unnamed1, complete sequence 22748-22779 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP031004 Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_1, complete sequence 41058-41089 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP021928 Pediococcus pentosaceus strain SRCM100194 plasmid pPP194-2, complete sequence 16218-16249 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 982599-982630 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NC_019369 Burkholderia cepacia plasmid pYS1, complete sequence 57587-57618 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN693890 Marine virus AFVG_250M637, complete genome 35981-36012 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN693630 Marine virus AFVG_250M640, complete genome 7790-7821 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN693538 Marine virus AFVG_25M196, complete genome 18902-18933 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN693980 Marine virus AFVG_250M1182, complete genome 7748-7779 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN694080 Marine virus AFVG_250M639, complete genome 7715-7746 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN694696 Marine virus AFVG_250M540, complete genome 37900-37931 9 0.719
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN694192 Marine virus AFVG_250M638, complete genome 36440-36471 9 0.719
NZ_CP042930_6 6.3|3729091|32|NZ_CP042930|CRISPRCasFinder,CRT 3729091-3729122 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 963148-963179 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP025884 Escherichia coli strain 503440 plasmid p503440_78, complete sequence 50594-50625 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP025893 Escherichia coli strain 503025 plasmid p503025_105, complete sequence 28024-28055 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP025866 Escherichia coli strain 504211 plasmid p504211_78, complete sequence 15823-15854 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP025872 Escherichia coli strain 503829 plasmid p503829_77, complete sequence 13033-13064 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP025914 Escherichia coli strain 203740 plasmid p203740_80, complete sequence 65754-65785 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP024231 Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed3, complete sequence 78583-78614 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 NZ_CP006002 Escherichia coli B7A plasmid pEB4, complete sequence 23295-23326 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 CP025899 Escherichia coli strain 500465 plasmid p500465_77, complete sequence 65750-65781 9 0.719
NZ_CP042930_6 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT 3729213-3729244 32 LN908839 Escherichia coli plasmid pCss_E1189 14928-14959 9 0.719
NZ_CP042930_6 6.13|3729703|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729703-3729734 32 NZ_CP021746 Agarilytica rhodophyticola strain 017 plasmid pSU2, complete sequence 42387-42418 9 0.719
NZ_CP042930_6 6.15|3729825|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729825-3729856 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 638437-638468 9 0.719
NZ_CP042930_6 6.16|3729886|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729886-3729917 32 NC_048687 Pseudomonas phage PMBT14, complete genome 16907-16938 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 KC691254 Mycobacterium phage Breezona, complete genome 34884-34915 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MF140422 Mycobacterium phage Nicholasp3, complete genome 34885-34916 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MN586052 Mycobacterium phage Kahlid, complete genome 34890-34921 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MK937600 Mycobacterium phage Wigglewiggle, complete genome 34917-34948 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MN234228 Mycobacterium phage Tourach, complete genome 34899-34930 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MN586030 Mycobacterium phage BobsGarage, complete genome 34884-34915 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MN703406 Mycobacterium phage Gabriela, complete genome 35146-35177 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MF324910 Mycobacterium phage GuuelaD, complete genome 34923-34954 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MH834600 Mycobacterium phage BigCheese, complete genome 34884-34915 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 NC_031124 Mycobacterium phage Gardann, complete genome 34885-34916 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 KC661276 Mycobacterium phage Winky, complete genome 34884-34915 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 NC_022071 Mycobacterium phage Crossroads, complete genome 34886-34917 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MN096380 Mycobacterium phage Lewan, complete genome 34877-34908 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MF185730 Mycobacterium phage Miley16, complete genome 34884-34915 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MF185728 Mycobacterium phage Finemlucis, complete genome 35160-35191 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 KX580962 Mycobacterium phage Wilder, complete genome 34890-34921 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 KU997639 Mycobacterium phage Loadrie, complete genome 34916-34947 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 KX580961 Mycobacterium phage Zakai, complete genome 35142-35173 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MN703410 Mycobacterium phage Itos, complete genome 33790-33821 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 MH779511 Mycobacterium phage LilDestine, complete genome 34882-34913 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 NC_015584 Mycobacterium virus Faith1, complete genome 34884-34915 9 0.719
NZ_CP042930_6 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR 3729947-3729978 32 KU234099 Mycobacterium phage MkaliMitinis3, complete genome 34886-34917 9 0.719
NZ_CP042930_6 6.31|3730797|32|NZ_CP042930|PILER-CR 3730797-3730828 32 NZ_CP017589 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ08, complete sequence 4085-4116 9 0.719
NZ_CP042930_6 6.36|3731102|32|NZ_CP042930|PILER-CR 3731102-3731133 32 NZ_LR135354 Enterococcus faecium isolate E8014 plasmid 4 4869-4900 9 0.719
NZ_CP042930_6 6.36|3731102|32|NZ_CP042930|PILER-CR 3731102-3731133 32 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 62469-62500 9 0.719
NZ_CP042930_6 6.41|3731408|32|NZ_CP042930|PILER-CR 3731408-3731439 32 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 72051-72082 9 0.719
NZ_CP042930_6 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder 3730784-3730815 32 NZ_CP017589 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ08, complete sequence 4085-4116 9 0.719
NZ_CP042930_6 6.60|3731089|32|NZ_CP042930|CRT,CRISPRCasFinder 3731089-3731120 32 NZ_LR135354 Enterococcus faecium isolate E8014 plasmid 4 4869-4900 9 0.719
NZ_CP042930_6 6.60|3731089|32|NZ_CP042930|CRT,CRISPRCasFinder 3731089-3731120 32 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 62469-62500 9 0.719
NZ_CP042930_6 6.65|3731395|32|NZ_CP042930|CRT,CRISPRCasFinder 3731395-3731426 32 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 72051-72082 9 0.719
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 625229-625262 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP015734 Arthrobacter sp. U41 plasmid unnamed2, complete sequence 113611-113644 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 648426-648459 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 669314-669347 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 575299-575332 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 233147-233180 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 101358-101391 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 107941-107974 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 385981-386014 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 574006-574039 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 109466-109499 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 101763-101796 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 108580-108613 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 858020-858053 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 86641-86674 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 58948-58981 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 59002-59035 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 385981-386014 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 129433-129466 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1175301-1175334 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 273819-273852 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 737563-737596 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 834795-834828 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 813708-813741 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 438174-438207 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 655172-655205 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 17280-17313 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 578083-578116 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 99847-99880 10 0.706
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 410838-410871 10 0.706
NZ_CP042930_3 3.13|3323046|34|NZ_CP042930|CRT 3323046-3323079 34 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1717171-1717204 10 0.706
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2002-2035 10 0.706
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 3003-3036 10 0.706
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165751-165784 10 0.706
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 MF140404 Arthrobacter phage Christian, complete genome 39999-40032 10 0.706
NZ_CP042930_3 3.30|3324114|34|NZ_CP042930|CRT 3324114-3324147 34 MK279862 Arthrobacter phage Lennox, complete genome 40006-40039 10 0.706
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 171820-171859 10 0.75
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165763-165802 10 0.75
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2020-2059 10 0.75
NZ_CP042930_3 3.40|3324606|40|NZ_CP042930|CRT 3324606-3324645 40 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 2979-3018 10 0.75
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 NZ_CP021660 Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-1, complete sequence 61898-61931 10 0.706
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 22024-22063 10 0.75
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 14595-14634 10 0.75
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 26834-26873 10 0.75
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 126584-126623 10 0.75
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 249081-249120 10 0.75
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 21497-21536 10 0.75
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 53488-53527 10 0.75
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN850643 Escherichia phage tiwna, complete genome 10098-10129 10 0.688
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NC_048206 Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 10425-10456 10 0.688
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 LR027385 Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 31666-31697 10 0.688
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 MN850641 Escherichia phage tonijn, complete genome 49963-49994 10 0.688
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 464820-464851 10 0.688
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 KJ944830 Pseudoalteromonas phage B8b, partial genome 7759-7790 10 0.688
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 552512-552543 10 0.688
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 551219-551250 10 0.688
NZ_CP042930_6 6.29|3730675|32|NZ_CP042930|PILER-CR 3730675-3730706 32 NC_009507 Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence 233658-233689 10 0.688
NZ_CP042930_6 6.32|3730858|32|NZ_CP042930|PILER-CR 3730858-3730889 32 MH617645 Inoviridae sp. isolate ctcb11, complete genome 2360-2391 10 0.688
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 552512-552543 10 0.688
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 551219-551250 10 0.688
NZ_CP042930_6 6.53|3730662|32|NZ_CP042930|CRT,CRISPRCasFinder 3730662-3730693 32 NC_009507 Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence 233658-233689 10 0.688
NZ_CP042930_6 6.56|3730845|32|NZ_CP042930|CRT,CRISPRCasFinder 3730845-3730876 32 MH617645 Inoviridae sp. isolate ctcb11, complete genome 2360-2391 10 0.688
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 265299-265332 11 0.676
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 625047-625080 11 0.676
NZ_CP042930_3 3.6|3322668|34|NZ_CP042930|CRT 3322668-3322701 34 NZ_AP022339 Mameliella alba strain KU6B plasmid pKUB112, complete sequence 36043-36076 11 0.676
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP045838 Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence 2002-2035 11 0.676
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_MK167988 Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence 3003-3036 11 0.676
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 165751-165784 11 0.676
NZ_CP042930_3 3.22|3323622|58|NZ_CP042930|CRT 3323622-3323679 58 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 590424-590481 11 0.81
NZ_CP042930_3 3.25|3323844|34|NZ_CP042930|CRT 3323844-3323877 34 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 436983-437016 11 0.676
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1802339-1802372 11 0.676
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5177483-5177516 11 0.676
NZ_CP042930_3 3.47|3325050|40|NZ_CP042930|CRT 3325050-3325089 40 NZ_CP041249 Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence 9127-9166 11 0.725
NZ_CP042930_6 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT 3729030-3729061 32 NZ_CP041164 Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence 17592-17623 11 0.656
NZ_CP042930_6 6.20|3730124|32|NZ_CP042930|PILER-CR 3730124-3730155 32 NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 168813-168844 11 0.656
NZ_CP042930_6 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder 3730111-3730142 32 NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 168813-168844 11 0.656
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1802185-1802218 12 0.647
NZ_CP042930_3 3.27|3323958|34|NZ_CP042930|CRT 3323958-3323991 34 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 648426-648459 12 0.647
NZ_CP042930_3 3.46|3324996|34|NZ_CP042930|CRT 3324996-3325029 34 MT028492 Ochrobactrum phage vB_OspP_OH, complete genome 8015-8048 12 0.647
NZ_CP042930_3 3.12|3322992|34|NZ_CP042930|CRT 3322992-3323025 34 NZ_CP020386 Rhodovulum sp. MB263 plasmid pRSMBB, complete sequence 44084-44117 14 0.588

1. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 0, identity: 1.0

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatcggcatccgca	Protospacer
**********************************

2. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatcagca	Protospacer
**********************

3. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

4. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

5. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

6. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

7. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

8. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

9. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

10. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

11. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

12. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

13. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

14. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

15. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

16. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

17. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

18. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

19. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

20. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

21. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

22. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

23. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

24. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

25. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

26. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

27. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

28. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

29. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

30. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

31. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

32. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

33. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

34. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

35. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

36. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

37. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

38. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

39. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

40. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

41. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

42. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

43. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

44. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

45. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

46. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

47. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

48. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

49. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

50. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

51. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

52. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

53. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

54. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

55. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

56. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

57. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

58. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

59. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

60. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

61. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

62. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

63. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

64. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

65. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

66. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

67. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

68. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

69. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

70. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

71. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

72. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

73. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

74. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

75. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

76. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

77. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

78. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

79. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

80. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

81. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

82. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

83. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

84. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

85. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

86. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

87. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

88. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

89. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

90. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

91. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

92. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

93. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

94. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

95. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

96. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

97. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

98. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

99. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

100. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

101. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

102. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

103. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

104. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

105. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

106. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

107. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

108. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

109. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

110. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

111. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

112. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

113. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

114. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

115. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

116. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

117. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

118. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

119. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

120. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

121. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

122. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

123. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

124. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

125. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

126. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

127. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

128. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

129. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

130. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

131. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

132. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

133. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

134. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

135. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

136. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

137. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

138. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

139. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

140. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

141. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

142. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

143. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

144. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

145. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

146. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

147. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

148. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

149. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

150. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

151. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

152. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

153. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

154. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

155. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

156. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

157. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

158. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

159. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

160. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

161. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

162. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

163. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

164. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

165. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

166. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

167. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

168. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

169. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

170. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

171. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

172. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

173. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

174. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

175. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

176. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

177. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

178. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

179. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

180. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

181. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

182. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

183. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

184. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

185. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

186. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

187. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

188. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

189. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

190. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

191. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

192. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

193. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

194. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

195. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

196. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

197. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

198. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

199. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

200. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

201. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

202. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

203. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

204. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

205. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

206. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

207. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

208. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

209. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

210. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

211. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

212. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

213. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

214. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

215. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

216. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

217. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

218. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

219. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

220. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

221. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

222. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

223. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

224. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

225. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

226. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

227. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

228. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

229. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

230. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

231. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

232. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

233. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

234. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

235. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

236. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

237. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

238. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

239. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

240. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

241. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

242. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

243. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

244. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

245. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

246. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

247. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

248. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

249. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

250. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

251. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

252. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

253. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

254. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

255. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

256. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

257. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

258. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

259. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

260. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

261. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

262. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

263. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

264. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

265. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

266. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

267. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

268. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

269. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

270. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

271. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

272. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

273. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

274. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

275. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

276. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

277. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

278. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

279. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

280. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

281. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

282. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

283. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

284. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

285. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

286. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

287. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

288. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

289. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

290. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

291. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

292. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

293. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

294. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

295. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

296. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

297. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

298. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

299. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

300. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

301. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

302. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

303. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

304. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

305. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

306. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

307. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

308. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

309. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

310. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

311. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

312. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

313. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

314. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

315. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

316. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

317. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

318. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

319. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

320. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

321. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

322. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

323. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

324. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

325. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

326. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

327. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

328. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

329. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

330. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

331. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

332. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

333. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

334. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

335. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

336. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

337. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

338. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

339. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

340. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

341. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

342. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
**********************

343. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
cgcgtcagcgtcagcgtcagca	Protospacer
******************** *

344. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 1, identity: 0.964

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcatcagcatcagca	Protospacer
******************.*********

345. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.964

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
***.************************

346. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.964

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
***.************************

347. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 1, identity: 0.964

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
***.************************

348. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 1, identity: 0.964

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
***.************************

349. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 1, identity: 0.971

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcgtccgcatcggcatccgca	Protospacer
***************.******************

350. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.971

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcatcggcatccgca	Protospacer
*********.************************

351. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.971

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcgtccgcatcggcatccgca	Protospacer
***************.******************

352. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.971

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcatcggcatccgca	Protospacer
************ *********************

353. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 1, identity: 0.971

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcgtccgcatcggcatccgca	Protospacer
***************.******************

354. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 1, identity: 0.971

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcgtccgcatcggcatccgca	Protospacer
***************.******************

355. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to CP003674 (Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence) position: , mismatch: 1, identity: 0.964

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatcggcgtctgcatcggca	Protospacer
***************************.

356. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 1, identity: 0.971

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatcggcatccgcgtcggcatcagcatctgcg	Protospacer
******.***************************

357. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatctgcatccgca	Protospacer
 *********************

358. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

359. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

360. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

361. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

362. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

363. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

364. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

365. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

366. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

367. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

368. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

369. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

370. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

371. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

372. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

373. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

374. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

375. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

376. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

377. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

378. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

379. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

380. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

381. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

382. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgca	Protospacer
****** ***************

383. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

384. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

385. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

386. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

387. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

388. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

389. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

390. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

391. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

392. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

393. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

394. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

395. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

396. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

397. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

398. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

399. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

400. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

401. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

402. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

403. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

404. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

405. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

406. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

407. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

408. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

409. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

410. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

411. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

412. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

413. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

414. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

415. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

416. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

417. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

418. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

419. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

420. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

421. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

422. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

423. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

424. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

425. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

426. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

427. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

428. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

429. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

430. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

431. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

432. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

433. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

434. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

435. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

436. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

437. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

438. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

439. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

440. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

441. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

442. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

443. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

444. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

445. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

446. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

447. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

448. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

449. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

450. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

451. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

452. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

453. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

454. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

455. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

456. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

457. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

458. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

459. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

460. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

461. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

462. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

463. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

464. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

465. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

466. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

467. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

468. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

469. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

470. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

471. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

472. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

473. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

474. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

475. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

476. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

477. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

478. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

479. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

480. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

481. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

482. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

483. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

484. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

485. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

486. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

487. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

488. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

489. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatcggcatccgca	Protospacer
************ *********

490. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatcggcatccgca	Protospacer
************ *********

491. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgca	Protospacer
****** ***************

492. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

493. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

494. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

495. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

496. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

497. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

498. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

499. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

500. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

501. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

502. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

503. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

504. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

505. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

506. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

507. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

508. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

509. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

510. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

511. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

512. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

513. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

514. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

515. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

516. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

517. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

518. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

519. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

520. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

521. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

522. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

523. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

524. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

525. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

526. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

527. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

528. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

529. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

530. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

531. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

532. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

533. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

534. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

535. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

536. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

537. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

538. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

539. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

540. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

541. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

542. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

543. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

544. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

545. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

546. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

547. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

548. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

549. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

550. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

551. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

552. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

553. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

554. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

555. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

556. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

557. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

558. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

559. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

560. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

561. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

562. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

563. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

564. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

565. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

566. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

567. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

568. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

569. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

570. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

571. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

572. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

573. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

574. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

575. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

576. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

577. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

578. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

579. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

580. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

581. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

582. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

583. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

584. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

585. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

586. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

587. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

588. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

589. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

590. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

591. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

592. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

593. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

594. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

595. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

596. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

597. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

598. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

599. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

600. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

601. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

602. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

603. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

604. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

605. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

606. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

607. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

608. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

609. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

610. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

611. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

612. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

613. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

614. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

615. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

616. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

617. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

618. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

619. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

620. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

621. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

622. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

623. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

624. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

625. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

626. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

627. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

628. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

629. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

630. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

631. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

632. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

633. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

634. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

635. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

636. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

637. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

638. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

639. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

640. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

641. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

642. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

643. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

644. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

645. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

646. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

647. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

648. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

649. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

650. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

651. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

652. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

653. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

654. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

655. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

656. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

657. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

658. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

659. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

660. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

661. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

662. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

663. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

664. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

665. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

666. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

667. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

668. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

669. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

670. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

671. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

672. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

673. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

674. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

675. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

676. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

677. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

678. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

679. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

680. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

681. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

682. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

683. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

684. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

685. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

686. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

687. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

688. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

689. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

690. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

691. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

692. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

693. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

694. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

695. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

696. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

697. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

698. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

699. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

700. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

701. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgca	Protospacer
************.*********

702. spacer 3.39|3324564|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

ggcgtcagaatcggcatcggca	CRISPR spacer
ggcgtcagcatcggcatcggca	Protospacer
******** *************

703. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to CP003674 (Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcgtctgcatcggcatcagca	Protospacer
***.******************

704. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatccgcatcggcatcagca	Protospacer
******.***************

705. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatccgcatcggcatcagca	Protospacer
******.***************

706. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatccgca	Protospacer
****************** ***

707. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatcggca	Protospacer
******************.***

708. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatccgcatcggcatcagca	Protospacer
******.***************

709. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcgtctgcatcggcatcagca	Protospacer
***.******************

710. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatctgca	Protospacer
****************** ***

711. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcgtcggcatcagca	Protospacer
*********.************

712. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcgtcagca	Protospacer
***************.******

713. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 1, identity: 0.955

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatccgcatcggcatcagca	Protospacer
******.***************

714. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

715. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

716. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

717. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

718. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgca	Protospacer
 *********************

719. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcg	Protospacer
*********************.

720. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
tgcatccgcatccgcatccgca	Protospacer
.*********************

721. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcg	Protospacer
*********************.

722. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
agcatccgcatccgcatccgca	Protospacer
 *********************

723. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcg	Protospacer
*********************.

724. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgca	Protospacer
****** ***************

725. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgca	Protospacer
****** ***************

726. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

727. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

728. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccaca	Protospacer
*******************.**

729. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

730. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

731. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

732. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

733. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

734. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

735. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

736. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

737. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

738. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

739. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

740. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

741. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

742. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

743. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

744. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

745. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

746. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

747. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

748. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

749. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

750. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

751. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

752. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

753. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

754. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

755. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

756. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

757. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

758. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

759. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

760. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

761. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

762. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

763. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

764. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

765. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

766. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

767. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

768. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

769. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

770. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

771. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

772. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

773. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

774. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP035508 (Haematobacter massiliensis strain OT1 plasmid pOT1-8, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

775. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgca	Protospacer
 *********************

776. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
tgcatccgcatccgcatccgca	Protospacer
.*********************

777. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatcggcatccgca	Protospacer
************ *********

778. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgca	Protospacer
****** ***************

779. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatcggca	Protospacer
****************** ***

780. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatcggcatccgca	Protospacer
************ *********

781. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

782. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

783. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
********************* 

784. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcacccgcatccgcatccgca	Protospacer
****.*****************

785. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgtatccgca	Protospacer
**************.*******

786. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatctgcatccgcatccgca	Protospacer
******.***************

787. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatctgcatccgcatccgca	Protospacer
******.***************

788. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.955

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcgtccgca	Protospacer
***************.******

789. spacer 3.52|3325332|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 1, identity: 0.955

agcatcagcatcagaatccgca	CRISPR spacer
agcatcagcatcagcatccgca	Protospacer
************** *******

790. spacer 3.52|3325332|22|NZ_CP042930|CRT matches to NC_016907 (Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence) position: , mismatch: 1, identity: 0.955

agcatcagcatcagaatccgca	CRISPR spacer
agcatcagcatcagaatcagca	Protospacer
****************** ***

791. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 1, identity: 0.969

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

792. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 1, identity: 0.969

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

793. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 1, identity: 0.969

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

794. spacer 3.7|3322722|22|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 2, identity: 0.909

ggcgtcagagtcggcgtctgca	CRISPR spacer
tgcgtcagcgtcggcgtctgca	Protospacer
 ******* *************

795. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcatccgca	Protospacer
************** *********** *

796. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
cgcgtcagcgtcagcgtcagcg	Protospacer
******************** .

797. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
ggcgtcagcgtcagcgtcagca	Protospacer
 ******************* *

798. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NC_016601 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED02, complete sequence) position: , mismatch: 2, identity: 0.909

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
ggcgccagcgtcagcgtcagaa	Protospacer
 ***.*****************

799. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
ggcgccagcgtcagcgtcagaa	Protospacer
 ***.*****************

800. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatccgcatccgcatcggcg	Protospacer
******************.***** *********

801. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggcg	Protospacer
****************** *****.*********

802. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcggcgtcagca	Protospacer
 ********************.******

803. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcgtcggcatcagca	Protospacer
***.***********.************

804. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatccgcatcggcatctgca	Protospacer
****** ***************** ***

805. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatccgca	Protospacer
***.******************** ***

806. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcagcatcagca	Protospacer
************ *****.*********

807. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagca	Protospacer
******.**************.******

808. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcggcatccgca	Protospacer
 *********************** ***

809. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcggca	Protospacer
***.********************.***

810. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatcggca	Protospacer
***************.********.***

811. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatcggca	Protospacer
***************.********.***

812. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatccgca	Protospacer
***.******************** ***

813. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcatcggcatcagcg	Protospacer
.**************************.

814. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcggcatcagcg	Protospacer
 **************************.

815. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcatcagca	Protospacer
.**************.************

816. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcatcagca	Protospacer
.**************.************

817. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcatcggcatccgcg	Protospacer
************************ **.

818. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcatcagca	Protospacer
.**************.************

819. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcatcggcatccgca	Protospacer
.*********************** ***

820. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcggca	Protospacer
***.********************.***

821. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatcggca	Protospacer
***************.********.***

822. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatcggca	Protospacer
***************.********.***

823. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatccgca	Protospacer
***.******************** ***

824. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

825. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

826. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

827. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

828. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

829. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

830. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

831. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

832. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

833. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

834. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

835. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

836. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

837. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

838. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

839. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

840. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

841. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

842. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

843. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

844. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

845. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

846. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

847. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

848. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

849. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

850. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

851. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

852. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

853. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

854. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

855. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcgtcagca	Protospacer
***.*****************.******

856. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcgtcagca	Protospacer
***.*****************.******

857. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagca	Protospacer
******.**************.******

858. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatctgcatccgcgtcggcatcagca	Protospacer
****** ********.************

859. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

860. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

861. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

862. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatcggca	Protospacer
***.********************.***

863. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagca	Protospacer
******.**************.******

864. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcatccgcatcggca	Protospacer
****************** *****.***

865. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatccgcatcggcatccgca	Protospacer
****** ***************** ***

866. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatccgcatcggcgtcagca	Protospacer
****** **************.******

867. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatctgcatcggcgtcagca	Protospacer
************.********.******

868. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

869. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 2, identity: 0.929

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggca	Protospacer
************ ***********.***

870. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatcggcatcggcgtccgca	Protospacer
****************** ********.******

871. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcgtccgca	Protospacer
*********************.*****.******

872. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcgtccgcatcggcatccgca	Protospacer
*********.*****.******************

873. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatctgcgtccgcatcggcatccgca	Protospacer
************ **.******************

874. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
agcatccgcatcggcatccgcgtcggcatccgca	Protospacer
.********************.************

875. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatccgcatccgcg	Protospacer
************************ ********.

876. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
agcatccgcatcggcatccgcgtcggcatccgca	Protospacer
.********************.************

877. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcgtcggcatccgcatcggcatccgca	Protospacer
****** **.************************

878. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatcggcgtcggca	Protospacer
***************************.** ***

879. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcagcgtcggcatccgcatcggcatccgca	Protospacer
****** **.************************

880. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatcggcgtcagca	Protospacer
***************************.** ***

881. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatcggcatccgcatccgcatccgca	Protospacer
 *********************** *********

882. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatccgcatccgcatcggcatccgca	Protospacer
****** ***** *********************

883. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatcggcatcggcgtccgca	Protospacer
****************** ********.******

884. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcgtccgca	Protospacer
*********************.*****.******

885. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcgtccgcatcggcatccgca	Protospacer
*********.*****.******************

886. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatctgcgtccgcatcggcatccgca	Protospacer
************ **.******************

887. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatcagcatcggcatccgcatcggcatccgca	Protospacer
 ***** ***************************

888. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatcggcatcagcg	Protospacer
****************************** **.

889. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.941

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcagcatcggcatccgcgtcggcatccgca	Protospacer
****** **************.************

890. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

891. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtcggcatcggcg	Protospacer
************ ***** *********

892. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

893. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

894. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

895. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

896. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

897. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgcg	Protospacer
************ *********** ***

898. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.941

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatcggcatccgcgtcggcatcagcatccgcg	Protospacer
******.***********************.***

899. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.941

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcatcagcatccgcgtcggcatcagcatccgcg	Protospacer
 *****************************.***

900. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatcggca	Protospacer
************ ************* *******

901. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.941

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatcggca	Protospacer
************ ************* *******

902. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
agcgtccgcatctgcatccgca	Protospacer
 **.******************

903. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

904. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

905. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

906. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

907. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

908. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgca	Protospacer
 ***********.*********

909. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcg	Protospacer
************.********.

910. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
tgcatccgcatccgcatccgca	Protospacer
.***********.*********

911. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcg	Protospacer
************.********.

912. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcgtccgcatctgcatccgca	Protospacer
 **.******************

913. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgcg	Protospacer
****** **************.

914. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

915. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgcg	Protospacer
****** **************.

916. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgcg	Protospacer
****** **************.

917. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
agcatccgcatccgcatccgca	Protospacer
 ***********.*********

918. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcg	Protospacer
************.********.

919. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

920. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

921. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

922. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

923. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

924. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

925. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

926. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

927. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

928. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

929. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

930. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

931. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

932. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatctgcgtccgca	Protospacer
 **************.******

933. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
agcatccgcatctgcgtccgca	Protospacer
 **************.******

934. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgca	Protospacer
 ***********.*********

935. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
agcatccgcatctgcatcggca	Protospacer
 ***************** ***

936. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
tgcatccgcatccgcatccgca	Protospacer
.***********.*********

937. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

938. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

939. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

940. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

941. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

942. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

943. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

944. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

945. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

946. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

947. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

948. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

949. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

950. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

951. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

952. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

953. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

954. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

955. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

956. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

957. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

958. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

959. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

960. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

961. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

962. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

963. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

964. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

965. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

966. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

967. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

968. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

969. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

970. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

971. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgcg	Protospacer
****** **************.

972. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatctgcgtccgca	Protospacer
 **************.******

973. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

974. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

975. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

976. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatcagcatctgcatccgca	Protospacer
 ***** ***************

977. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
tgcatccgcatctgcgtccgca	Protospacer
.**************.******

978. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

979. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP035507 (Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatctacatccgca	Protospacer
 ************.********

980. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP035508 (Haematobacter massiliensis strain OT1 plasmid pOT1-8, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

981. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatcggcatctgcatccgcg	Protospacer
****** **************.

982. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatctgcgtccgca	Protospacer
 **************.******

983. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

984. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

985. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

986. spacer 3.32|3324216|22|NZ_CP042930|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatctgcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcc	Protospacer
************.******** 

987. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 2, identity: 0.929

cgcgtcggaatcggaatcggaatcggca	CRISPR spacer
ggcgtcggaatcggcatcggaatcggca	Protospacer
 ************* *************

988. spacer 3.39|3324564|22|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgtcagaatcggcatcggca	CRISPR spacer
cgcgtcagcatcggcatcggca	Protospacer
 ******* *************

989. spacer 3.39|3324564|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgtcagaatcggcatcggca	CRISPR spacer
cgcgtcagcatcggcatcggca	Protospacer
 ******* *************

990. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcagcg	Protospacer
****** **************.

991. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcagcg	Protospacer
****** **************.

992. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcgtcagcg	Protospacer
***************.*****.

993. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
agcatctgcgtcggcatcagca	Protospacer
.********.************

994. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatccgcg	Protospacer
****************** **.

995. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
agcatctgcatcggcatcggca	Protospacer
.*****************.***

996. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
tgcatctgcatctgcatcagca	Protospacer
 *********** *********

997. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatccgcatcggcatcagcg	Protospacer
******.**************.

998. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatccgcatcggcatcagcg	Protospacer
******.**************.

999. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
agcatctgcgtcggcatcagca	Protospacer
.********.************

1000. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
cgcatctgcatcggcatccgca	Protospacer
 ***************** ***

1001. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatccgcg	Protospacer
****************** **.

1002. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatccgcg	Protospacer
****************** **.

1003. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
agcatctgcgtcggcatcagca	Protospacer
.********.************

1004. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
cgcatctgcgtcggcatcagca	Protospacer
 ********.************

1005. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
cgcatctgcgtcggcatcagca	Protospacer
 ********.************

1006. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
cgcatctgcgtcggcatcagca	Protospacer
 ********.************

1007. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
agcatcggcatcggcatcagca	Protospacer
.***** ***************

1008. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatccgcc	Protospacer
****************** ** 

1009. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggcatctgcg	Protospacer
****************** **.

1010. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
tgcatctgcgtcggcatcagca	Protospacer
 ********.************

1011. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
tgcatctgcgtcggcatcagca	Protospacer
 ********.************

1012. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
tgcatctgcgtcggcatcagca	Protospacer
 ********.************

1013. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
tgcatctgcgtcggcatcagca	Protospacer
 ********.************

1014. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
ggcatctgcatcggaatcagcc	Protospacer
************** ****** 

1015. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
tgcatctgcatcggcatcggca	Protospacer
 *****************.***

1016. spacer 3.41|3324666|22|NZ_CP042930|CRT matches to MN693976 (Marine virus AFVG_250M247, complete genome) position: , mismatch: 2, identity: 0.909

ggcatctgcatcggcatcagca	CRISPR spacer
cgcatcagcatcggcatcagca	Protospacer
 ***** ***************

1017. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
aacatccgcatccgcatccgca	Protospacer
 .********************

1018. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1019. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1020. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1021. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1022. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1023. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1024. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1025. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatctgcatccgcatccgca	Protospacer
 *****.***************

1026. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatcggcatccgcatccgca	Protospacer
 ***** ***************

1027. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatcggca	Protospacer
 ***************** ***

1028. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1029. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1030. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1031. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatccgcg	Protospacer
 ********************.

1032. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1033. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatcggcatccgcatccgca	Protospacer
 ***** ***************

1034. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatccgcatcggca	Protospacer
 ***************** ***

1035. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1036. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatcggcatccgcatccgca	Protospacer
 ***** ***************

1037. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatctgcatccgcatccgca	Protospacer
 *****.***************

1038. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatcagcg	Protospacer
****************** **.

1039. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcacccgcg	Protospacer
****************.****.

1040. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
agcatccgcatccgcatccgcg	Protospacer
 ********************.

1041. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1042. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1043. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1044. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1045. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
agcatccgcatccgcatccgcg	Protospacer
 ********************.

1046. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
tgcatccgcatccgcatccgcg	Protospacer
.********************.

1047. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
tgcatccgcatccgcatccgcg	Protospacer
.********************.

1048. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatctgcatccgca	Protospacer
 ***********.*********

1049. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
agcatccgcatccgcatccgcg	Protospacer
 ********************.

1050. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1051. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
agcatccgcatccgcatccgcg	Protospacer
 ********************.

1052. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1053. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1054. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcgtccgcatccgcatccgca	Protospacer
 **.******************

1055. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatcggcg	Protospacer
****************** **.

1056. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1057. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP049032 (Fluviibacterium aquatile strain SC52 plasmid pSC52_4, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcacccgct	Protospacer
****************.**** 

1058. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
ggcatccgcatcggcatccgca	Protospacer
 *********** *********

1059. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatcctcg	Protospacer
******************* *.

1060. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatgcgct	Protospacer
***************** *** 

1061. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatcggcatccgcatccgcg	Protospacer
****** **************.

1062. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to MN693610 (Marine virus AFVG_250M347, complete genome) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatctgcg	Protospacer
******************.**.

1063. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to MN693983 (Marine virus AFVG_250M348, complete genome) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatctgcg	Protospacer
******************.**.

1064. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to MN693937 (Marine virus AFVG_250M350, complete genome) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatctgcg	Protospacer
******************.**.

1065. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to MN694384 (Marine virus AFVG_250M349, complete genome) position: , mismatch: 2, identity: 0.909

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatctgcg	Protospacer
******************.**.

1066. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to KC911857 (Salmonella phage SPC32N, complete genome) position: , mismatch: 2, identity: 0.938

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

1067. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to KC911856 (Salmonella phage SPC32H, complete genome) position: , mismatch: 2, identity: 0.938

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

1068. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NC_016761 (Salmonella phage SPN1S, complete genome) position: , mismatch: 2, identity: 0.938

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

1069. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to JQ691610 (Salmonella phage SPN9TCW, complete genome) position: , mismatch: 2, identity: 0.938

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

1070. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 2, identity: 0.938

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtagac	Protospacer
***** *********************** **

1071. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcatccgcg	Protospacer
************** *********** .

1072. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcatccgcg	Protospacer
************** *********** .

1073. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatcggcatccgca	Protospacer
************** *** ******* *

1074. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatcggcatccgcatccgca	Protospacer
************ * *********** *

1075. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1076. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1077. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1078. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1079. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1080. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1081. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1082. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1083. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1084. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1085. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1086. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1087. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1088. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1089. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1090. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1091. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1092. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1093. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1094. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1095. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1096. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP033584 (Streptomyces sp. ADI95-16 plasmid pADI95-16c, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
ggcgtcagcgtcagcgtcaggt	Protospacer
 *******************. 

1097. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1098. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1099. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagtg	Protospacer
 ******************* .

1100. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1101. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1102. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1103. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1104. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1105. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1106. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1107. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1108. spacer 3.10|3322878|22|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 3, identity: 0.864

cgcgtcagcgtcagcgtcagaa	CRISPR spacer
agcgtcagcgtcagcgtcagcg	Protospacer
 ******************* .

1109. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1110. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1111. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1112. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1113. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1114. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1115. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1116. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtcggcatcggca	Protospacer
*********************.**.********.

1117. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtcggcatcggca	Protospacer
*********************.**.********.

1118. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtctgcatcggca	Protospacer
*********************.** ********.

1119. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1120. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1121. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1122. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1123. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1124. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1125. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1126. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1127. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1128. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1129. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1130. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1131. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1132. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1133. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcggca	Protospacer
****************** *****.********.

1134. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.912

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
cgcatcggcatccgcgtcagcgtcagcgtcagcg	Protospacer
.***** ***** *********************

1135. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatcggcatccgcatcagca	Protospacer
.*********** ***** *********

1136. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcatccgcg	Protospacer
******.***************** **.

1137. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatccgca	Protospacer
 **************.******** ***

1138. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcatccgca	Protospacer
 **.******************** ***

1139. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatccgca	Protospacer
 ********.************** ***

1140. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatccgcatccgcgtcggcatcagca	Protospacer
 ***** ********.************

1141. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcg	Protospacer
******.**************.*****.

1142. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcatccgcg	Protospacer
******.***************** **.

1143. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatccgca	Protospacer
 **************.******** ***

1144. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcatctgcg	Protospacer
******.***************** **.

1145. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcatccgcatcggcg	Protospacer
****************** *****.**.

1146. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatccgcatcggcgtcagcg	Protospacer
****** **************.*****.

1147. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatctgcatccgcatcggcatctgca	Protospacer
 ***** ***************** ***

1148. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatccgcg	Protospacer
***.******************** **.

1149. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcggcgtcggca	Protospacer
 ********************.**.***

1150. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatccgcatccgcgtcggcatcagca	Protospacer
 ***** ********.************

1151. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatccgcatccgcgtcggcatcagca	Protospacer
 ***** ********.************

1152. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcgtcagca	Protospacer
.**.*****************.******

1153. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcatccgca	Protospacer
.**.******************** ***

1154. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcatcggcgtcagcg	Protospacer
.********************.*****.

1155. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatccgca	Protospacer
 ********.************** ***

1156. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatccgcg	Protospacer
***************.******** **.

1157. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcg	Protospacer
******.**************.*****.

1158. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatccgcg	Protospacer
***.******************** **.

1159. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcg	Protospacer
******.**************.*****.

1160. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatcggcg	Protospacer
***************.********.**.

1161. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcgtcagca	Protospacer
.**************.*****.******

1162. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcatctgca	Protospacer
.**************.******** ***

1163. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcgtccgcatcagcatcagca	Protospacer
 ********.********.*********

1164. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcatcggcgtcagcg	Protospacer
.********************.*****.

1165. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatccgca	Protospacer
 ********.************** ***

1166. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatccgcg	Protospacer
***************.******** **.

1167. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcg	Protospacer
******.**************.*****.

1168. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatccgcatcggcatccgcg	Protospacer
***.******************** **.

1169. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcg	Protospacer
******.**************.*****.

1170. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatcggcg	Protospacer
***************.********.**.

1171. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatcggcatcggcatcggca	Protospacer
 *********** ***********.***

1172. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1173. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatctgcatcggcatctgcg	Protospacer
************.*********** **.

1174. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcgtcagcg	Protospacer
************ ********.*****.

1175. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcg	Protospacer
************ ***********.**.

1176. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatctgcg	Protospacer
************ *********** **.

1177. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatctgcg	Protospacer
************ *********** **.

1178. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatctgcg	Protospacer
************ *********** **.

1179. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatctgcg	Protospacer
************ *********** **.

1180. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcg	Protospacer
************ ***********.**.

1181. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcgtcagcg	Protospacer
************ ********.*****.

1182. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gacatcggcatcggcatcggcatcggca	Protospacer
*.********** ***********.***

1183. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatcggcatcggcatcggca	Protospacer
 *********** ***********.***

1184. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcgtccgcatcggcatctgca	Protospacer
.********.************** ***

1185. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatctgcatcggcatctgca	Protospacer
 ***********.*********** ***

1186. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatcggca	Protospacer
 **************.********.***

1187. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatcggca	Protospacer
 **************.********.***

1188. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatcggcatcggcgtcagca	Protospacer
 *********** ********.******

1189. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcgtcagca	Protospacer
.**.*****************.******

1190. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcg	Protospacer
******.**************.*****.

1191. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcatctgca	Protospacer
.**************.******** ***

1192. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcgtcggcatccgcg	Protospacer
***************.******** **.

1193. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggcatccgcg	Protospacer
************ *********** **.

1194. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcgtcggcatccgca	Protospacer
.**************.******** ***

1195. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcagcatccgcgtcggcatcagca	Protospacer
 *****.********.************

1196. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcg	Protospacer
************ ***********.**.

1197. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatccgcatcggcgtcagcg	Protospacer
 ********************.*****.

1198. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatccgcatcggcatctgcg	Protospacer
.*********************** **.

1199. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatctgcgtcggcatcagca	Protospacer
 ***********.**.************

1200. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggcgtcagcg	Protospacer
************ ********.*****.

1201. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatccgcatccgca	Protospacer
 ***************** ***** ***

1202. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatccgcatccgcatcggcatccgca	Protospacer
 ***** ***************** ***

1203. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatccgcgtcggcatcagcg	Protospacer
****** ********.***********.

1204. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatccgcatccgcatccgcg	Protospacer
****************** ***** **.

1205. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcgtcagca	Protospacer
.**.*****************.******

1206. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatccgcatcggcgtcagcg	Protospacer
****** **************.*****.

1207. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatctgcatcggcatccgcg	Protospacer
************.*********** **.

1208. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatcggcatcggcatcggca	Protospacer
 *********** ***********.***

1209. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatcggcatcggcatcggca	Protospacer
.*********** ***********.***

1210. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP003674 (Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcgtctgcatcggcatcagca	Protospacer
 ********.**.***************

1211. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1212. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatcggcatcggcatcagcg	Protospacer
***.******** **************.

1213. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatctgcatcggcatcagca	Protospacer
.**.********.***************

1214. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatcggcatcggcatcagcg	Protospacer
***.******** **************.

1215. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1216. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcg	Protospacer
************ ***********.**.

1217. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1218. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1219. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1220. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatccgca	Protospacer
 ********.************** ***

1221. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1222. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcc	Protospacer
************ ***********.** 

1223. spacer 3.17|3323268|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.925

ggcatctgcatcggcgtcagcgtctgcatctgaatcagca	CRISPR spacer
ggcatcggcatcggcgtcagcgtctgcatctgaatctgaa	Protospacer
****** ***************************** * *

1224. spacer 3.17|3323268|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.925

ggcatctgcatcggcgtcagcgtctgcatctgaatcagca	CRISPR spacer
ggcatcggcatcggcgtcagcgtctgcatctgaatctgaa	Protospacer
****** ***************************** * *

1225. spacer 3.26|3323898|40|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.925

ggcatcagcgtcggcgtccgcatccgcatccgcgtcagca	CRISPR spacer
ggcatcagcgtcagcgtccgcatcggcatccgcgtcagcg	Protospacer
************.*********** **************.

1226. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatccgcgtcggcatccgcatcggcgtccgca	Protospacer
 ********.*****************.******

1227. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatcggcatcggcatccgcg	Protospacer
*********.******** **************.

1228. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggcatccgcg	Protospacer
*********.***********.***********.

1229. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggcatccgcg	Protospacer
*********.***********.***********.

1230. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcgtcggcatccgcgtcggcatccgca	Protospacer
 ********.***********.************

1231. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcatcggcatctgcg	Protospacer
*********.********************.**.

1232. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatcagcatctgcg	Protospacer
************************.*****.**.

1233. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgtccgcatcggcatccgcatccgcatccgcg	Protospacer
***.******************** ********.

1234. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcgtcggcatccgca	Protospacer
 *********** ********.************

1235. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcatccgcatccgcg	Protospacer
*********.************** ********.

1236. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcgtcggcatcggcatcggcatccgca	Protospacer
 ********.******** ***************

1237. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcatctgcg	Protospacer
*********************.********.**.

1238. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatcggcatcggcatctgcg	Protospacer
****************** ***********.**.

1239. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcatcggcatctgcg	Protospacer
*********.********************.**.

1240. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatccgcgtcggcatccgcatcggcgtccgca	Protospacer
 ********.*****************.******

1241. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatccgcgtcggcatccgcatcggcgtccgca	Protospacer
 ********.*****************.******

1242. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatcggcatcggcatccgcg	Protospacer
*********.******** **************.

1243. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggcatccgcg	Protospacer
*********.***********.***********.

1244. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggcatccgcg	Protospacer
*********.***********.***********.

1245. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcgtcggcatccgcgtcggcatccgca	Protospacer
 ********.***********.************

1246. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcatcggcatctgcg	Protospacer
*********.********************.**.

1247. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcgtccgcatcggcatccgcg	Protospacer
*********.*****.*****************.

1248. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatcggcgtccgcgtcggcatccgca	Protospacer
 **************.*****.************

1249. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatcggcatccgcatcagcatctgcg	Protospacer
************************.*****.**.

1250. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatcggcatcggcatccgcatcggcatccgcg	Protospacer
 ***** **************************.

1251. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcagcatcggcatcggcatcggcatccgcg	Protospacer
****** *********** **************.

1252. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatccgcg	Protospacer
****** **************.***********.

1253. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcgtcggcatccgcatcagcatccgcg	Protospacer
*********.**************.********.

1254. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1255. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1256. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1257. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1258. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1259. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1260. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1261. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1262. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1263. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1264. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1265. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1266. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1267. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1268. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1269. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1270. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1271. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1272. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1273. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1274. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1275. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1276. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1277. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1278. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1279. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1280. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1281. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1282. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1283. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1284. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1285. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1286. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
agcatccgcatccgcatccgcgtcggcatccgca	Protospacer
.*********** ********.************

1287. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatccgcatctgcatccgcatccgcatccgcg	Protospacer
************ *********** ********.

1288. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1289. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1290. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1291. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1292. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1293. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1294. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1295. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1296. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1297. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1298. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1299. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1300. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1301. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1302. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1303. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1304. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1305. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1306. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1307. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1308. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1309. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1310. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1311. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1312. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1313. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1314. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1315. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1316. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1317. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1318. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1319. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1320. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1321. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1322. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1323. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1324. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1325. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1326. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1327. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1328. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1329. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1330. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1331. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1332. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1333. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1334. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1335. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1336. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1337. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1338. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1339. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1340. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1341. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1342. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1343. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1344. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1345. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1346. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1347. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1348. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1349. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1350. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1351. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1352. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1353. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1354. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1355. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1356. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1357. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1358. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1359. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1360. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1361. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1362. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1363. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1364. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1365. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1366. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1367. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1368. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1369. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1370. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1371. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1372. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1373. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1374. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1375. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1376. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1377. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1378. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1379. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1380. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1381. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1382. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1383. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1384. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1385. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1386. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1387. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1388. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1389. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1390. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1391. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1392. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1393. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1394. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1395. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1396. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1397. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1398. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1399. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1400. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1401. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1402. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1403. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1404. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1405. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1406. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1407. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1408. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1409. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1410. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1411. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1412. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1413. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1414. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1415. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1416. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1417. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1418. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1419. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1420. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1421. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1422. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1423. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1424. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1425. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1426. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1427. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1428. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1429. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1430. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1431. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1432. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1433. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1434. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1435. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1436. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1437. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1438. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1439. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1440. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1441. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1442. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1443. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1444. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1445. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1446. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1447. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1448. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1449. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1450. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1451. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1452. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1453. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1454. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1455. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1456. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1457. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1458. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1459. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1460. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1461. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1462. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1463. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1464. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1465. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1466. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1467. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1468. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1469. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1470. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1471. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1472. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1473. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1474. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1475. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1476. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1477. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1478. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1479. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1480. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1481. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1482. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1483. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1484. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1485. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1486. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1487. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1488. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1489. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1490. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1491. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1492. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1493. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1494. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1495. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.912

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgca	Protospacer
 *********** *********** *********

1496. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtcggcatcggcgtcggcatcggca	Protospacer
****** *********** ********.

1497. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1498. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1499. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1500. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1501. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcgtctgcatctgcg	Protospacer
.*********** *********** ***

1502. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtcagcgtcggcgtctgcatcggcg	Protospacer
 ***** **.******************

1503. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcgtctgcatctgcg	Protospacer
.*********** *********** ***

1504. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcgtctgcatctgcg	Protospacer
.*********** *********** ***

1505. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1506. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1507. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1508. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1509. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtcggcatcggcgtcggcatcggca	Protospacer
****** *********** ********.

1510. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgcg	Protospacer
 *********** *********** ***

1511. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgca	Protospacer
************ *********** **.

1512. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcagcggcgtctgcagcggcg	Protospacer
.********* *********** *****

1513. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcagcggcgtctgcagcggcg	Protospacer
.********* *********** *****

1514. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcagcggcgtctgcagcggcg	Protospacer
.********* *********** *****

1515. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcagcggcgtctgcagcggcg	Protospacer
.********* *********** *****

1516. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.893

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtcggcatcggcatctgcatcggca	Protospacer
****** ********.***********.

1517. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatcggcatccgcgtcggcatcagcatcagca	Protospacer
******.*********************** **.

1518. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatctgcatccgcgtcggcatcagcatctgca	Protospacer
.***** **************************.

1519. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatctgcatctgcgtcggcatcagcatctgca	Protospacer
****** *****.********************.

1520. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatctgcatctgcgtcggcatcagcatctgca	Protospacer
****** *****.********************.

1521. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatctgcatctgcgtcggcatcagcatctgca	Protospacer
****** *****.********************.

1522. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatctgcatctgcgtcggcatcagcatctgca	Protospacer
****** *****.********************.

1523. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatctgcatccgcgtcggcatcggcatctgcg	Protospacer
.***** *****************.*********

1524. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcatcggcatccgcgtcggcatcggcatctgcg	Protospacer
 *****.*****************.*********

1525. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcatcggcatccgcgtcggcatcggcatctgcg	Protospacer
 *****.*****************.*********

1526. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 3, identity: 0.912

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcatctgcg	Protospacer
.**************.*****.************

1527. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
 ***********.************* *******

1528. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
 ***********.************* *******

1529. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
ggcatcggcatctgcatccgcgtcggcatcggca	Protospacer
 *********** ************* *******

1530. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatcggcg	Protospacer
************ ************* ******.

1531. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
 ***********.************* *******

1532. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
 ***********.************* *******

1533. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
ggcatcggcatctgcatccgcgtcggcatcggca	Protospacer
 *********** ************* *******

1534. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.912

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatcggcg	Protospacer
************ ************* ******.

1535. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatccgcgtcggcg	Protospacer
 * *************** *********

1536. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcg	Protospacer
** .************** *********

1537. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
** .***********.************

1538. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatccgcgtcggcg	Protospacer
 * *************** *********

1539. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcg	Protospacer
** .************** *********

1540. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
** .***********.************

1541. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
** .***********.************

1542. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gcagtccgcatcggcatcggcgtcagcg	Protospacer
* ****************.*****.***

1543. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcgtccgcatccgcatccgcatcggcg	Protospacer
****************** * ***** *

1544. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcggca	Protospacer
 * *********************** *

1545. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1546. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtcggcgtcggca	Protospacer
** ***************.******* *

1547. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtcggcgtcggca	Protospacer
** ***************.******* *

1548. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1549. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtcggcgtcggca	Protospacer
** ***************.******* *

1550. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1551. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1552. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1553. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtcggcgtcggca	Protospacer
** ***************.******* *

1554. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtcggcgtcggca	Protospacer
** ***************.******* *

1555. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1556. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1557. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 3, identity: 0.893

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
** ********* ************* *

1558. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.864

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatcctgg	Protospacer
*******************  .

1559. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP023721 (Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.864

cgcatccgcatccgcatccgca	CRISPR spacer
agcatccgcatccgcatccggc	Protospacer
 *******************  

1560. spacer 3.50|3325230|22|NZ_CP042930|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 3, identity: 0.864

cgcatccgcatccgcatccgca	CRISPR spacer
cgcatccgcatccgcatcctgg	Protospacer
*******************  .

1561. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcatccgcg	Protospacer
 ************* *********** .

1562. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcatccgcg	Protospacer
 ************* *********** .

1563. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcggcatccgca	Protospacer
 ************* *** ******* *

1564. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcatcggca	Protospacer
 ************* ********* * *

1565. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatccgca	Protospacer
.************* *** ******* *

1566. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcagcatccgcatccgcatccgca	Protospacer
.*****.******* *********** *

1567. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcatccgcg	Protospacer
 ************* *********** .

1568. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcatcggcg	Protospacer
************** ********* * .

1569. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatcggcatccgcatccgca	Protospacer
.*********** * *********** *

1570. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcatcggcatccgcatccgcatccgca	Protospacer
 **.********** *********** *

1571. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatccgca	Protospacer
.************* *** ******* *

1572. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggca	Protospacer
************** ******.** * *

1573. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatctgcatccgca	Protospacer
 ************* ***.******* *

1574. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcgtccgcatccgcatccgca	Protospacer
 ********.**** *********** *

1575. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatccgca	Protospacer
.************* *** ******* *

1576. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggca	Protospacer
************** ******.** * *

1577. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tgcgtccgcatcggcatctgcatcagcatcggca	Protospacer
 **.** **************************.

1578. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgggt	Protospacer
****************** *****.*******  

1579. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg-	CRISPR spacer
ggcgtcggcatcggcatctgcgtc-gcatccgcgt	Protospacer
***.*****************.** ***** *** 

1580. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tgcatcggcatcggcatcggcatcggcatcggca	Protospacer
 ***************** *****.********.

1581. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tgcatcggcatcggcatcggcatcggcatcggca	Protospacer
 ***************** *****.********.

1582. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
agcatcggcatcggcatccgcatcagcatcagca	Protospacer
.*****************.***********.**.

1583. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tgcatcggcatcggcatcggcatcggcatcggca	Protospacer
 ***************** *****.********.

1584. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tgcatccgcgtcggcatctgcatcagcatcggca	Protospacer
 ***** **.***********************.

1585. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgccc	Protospacer
****************** *****.****** * 

1586. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
gacatcggcatcggcatcggcatcggcatcggca	Protospacer
*.**************** *****.********.

1587. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.882

-ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggtcatccg-atcggcatcggcatcagcatcggcg	Protospacer
 * **** * ********* ***************

1588. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
ggcatcagcatccgcgtcagcgtcagcgtcagca	Protospacer
 ***** ***** ********************.

1589. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.882

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
cgcatccgcatcagcgtcagcgtcagcgtcggca	Protospacer
.*****.***********************.**.

1590. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.882

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
ggcatcagcatcggcgtcagcgtcagcgtcagca	Protospacer
 ***** *****.********************.

1591. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 4, identity: 0.882

---tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tcatgca---gcgtcagcgtcagcgtcagcgtcagcg	Protospacer
   ****   **.************************

1592. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 4, identity: 0.882

---tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tcatgca---gcgtcagcgtcagcgtcagcgtcagcg	Protospacer
   ****   **.************************

1593. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 4, identity: 0.882

---tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tcatgca---gcgtcagcgtcagcgtcagcgtcagcg	Protospacer
   ****   **.************************

1594. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 4, identity: 0.882

---tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tcatgca---gcgtcagcgtcagcgtcagcgtcagcg	Protospacer
   ****   **.************************

1595. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatccgcatccgcg	Protospacer
 ***************** ***** **.

1596. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatctgcg	Protospacer
 ********.************** **.

1597. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatccgcatccgcg	Protospacer
 ***************** ***** **.

1598. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatctgcg	Protospacer
 ********.************** **.

1599. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatctgcg	Protospacer
 ********.************** **.

1600. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcatcggcatctgcg	Protospacer
 ********.************** **.

1601. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatctgcatcggcgtcagcg	Protospacer
 ***********.********.*****.

1602. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatctgcg	Protospacer
 **************.******** **.

1603. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatcggcatcggcgtcagcg	Protospacer
 *********** ********.*****.

1604. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatccgcgtcggcatctgcg	Protospacer
 **************.******** **.

1605. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcagcatccgcatcggcgtcagcg	Protospacer
 *****.**************.*****.

1606. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatctgcg	Protospacer
 *****************.***** **.

1607. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 **.******************** **.

1608. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 **.******************** **.

1609. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcatctgcg	Protospacer
.**.******************** **.

1610. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcgtcagcg	Protospacer
 **.*****************.*****.

1611. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcgtcagcg	Protospacer
.**.*****************.*****.

1612. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatctgcg	Protospacer
 *****************.***** **.

1613. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatcggcg	Protospacer
 *****************.*****.**.

1614. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcagcatccgcatcggcgtcagcg	Protospacer
 *****.**************.*****.

1615. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatctgcg	Protospacer
 *****************.***** **.

1616. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 **.******************** **.

1617. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 **.******************** **.

1618. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcatctgcg	Protospacer
.**.******************** **.

1619. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatcggcg	Protospacer
 **************.********.**.

1620. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcgtcagcg	Protospacer
 **.*****************.*****.

1621. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcgtcagcg	Protospacer
 **.*****************.*****.

1622. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcgtcggcatccgcatcggcgtcagcg	Protospacer
.**.*****************.*****.

1623. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatctgcg	Protospacer
 *****************.***** **.

1624. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatcggcg	Protospacer
 *****************.*****.**.

1625. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaga	Protospacer
************ ***********.. *

1626. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgggt	Protospacer
************ ***********.*  

1627. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatctgcatctgcatcggcatctgaa	Protospacer
****** *****.*********** * *

1628. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatctgcatcggcatctgaa	Protospacer
***.********.*********** * *

1629. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcgtcggcatctgcatcggcatctgaa	Protospacer
***.********.*********** * *

1630. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgccc	Protospacer
************ ***********. * 

1631. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ttcatcggcatcggcatcggcatcggca	Protospacer
  ********** ***********.***

1632. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ttcatcggcatcggcatcggcatcggca	Protospacer
  ********** ***********.***

1633. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ttcatcggcatcggcatcggcatcggca	Protospacer
  ********** ***********.***

1634. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcgtcagcg	Protospacer
 **.*****************.*****.

1635. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcgtcggcatccgcg	Protospacer
 **************.******** **.

1636. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatcggcatcggcatccgcg	Protospacer
.*********** *********** **.

1637. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gtcgtcggcatcggcatcggcatcggca	Protospacer
* *.******** ***********.***

1638. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatcggcatcggcatctgcg	Protospacer
 *********** *********** **.

1639. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcgtcggcatccgcatcggcatctgcg	Protospacer
 **.******************** **.

1640. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 **.******************** **.

1641. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatccgcatcagcatctgcg	Protospacer
 *****************.***** **.

1642. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatccgcatccgcatccgcatcagcg	Protospacer
 ***** *********** ********.

1643. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatccgcgtcggcatctgcg	Protospacer
 **************.******** **.

1644. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatccgcgtcggcatctgcg	Protospacer
 **************.******** **.

1645. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggtttcggcatcggcatcggcatcggca	Protospacer
**. ******** ***********.***

1646. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP040758 (Paracoccus sp. 2251 plasmid unnamed7, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatctgcatccgcatctgcatcaggt	Protospacer
****** *********** *******  

1647. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcataggcg	Protospacer
************ ********** .**.

1648. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.857

ggcatcggcatccgcatcggcatcagca-	CRISPR spacer
cgcatcggcatgcgcatcggcat-agcgg	Protospacer
 ********** *********** ***. 

1649. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatcggca	Protospacer
 *********** ************* ***** *

1650. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatcggca	Protospacer
 *********** ************* ***** *

1651. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
.***********.************* ***** *

1652. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
.***********.************* ***** *

1653. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatctgcatccgcgtcggcatcggca	Protospacer
.*********** ************* ***** *

1654. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
.***********.************* ***** *

1655. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatcggca	Protospacer
.***********.************* ***** *

1656. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatctgcatccgcgtcggcatcggca	Protospacer
.*********** ************* ***** *

1657. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcgtcggcatcggcatcggcatccgcg	Protospacer
 ********.******** **************.

1658. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatcggcatcagcatccgcatcggcatccgcg	Protospacer
 ***** *****.********************.

1659. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatccgcatcggcgtccgcatcggcatctgcg	Protospacer
 **************.**************.**.

1660. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatccgcatccgcatccgcatccgcatccgcg	Protospacer
 *********** *********** ********.

1661. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcgtcggcatccgcatccgcatccgcg	Protospacer
 ********.************** ********.

1662. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatcggcatcagcatccgcatcggcatccgcg	Protospacer
 ***** *****.********************.

1663. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatccgcatcggcgtccgcatcggcatctgcg	Protospacer
 **************.**************.**.

1664. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
agcatccgcatccgcatccgcatccgcatccgcg	Protospacer
.*********** *********** ********.

1665. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcgtcggcatcggcatcggcatccgcg	Protospacer
 ********.******** **************.

1666. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatcagcatcggcatccgcatcggcatcagcg	Protospacer
 ***** *********************** **.

1667. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
agcatcggcatcggcatcagcatcggcatccgcg	Protospacer
.***** *********** **************.

1668. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1669. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1670. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1671. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1672. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1673. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1674. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1675. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1676. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1677. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1678. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1679. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1680. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1681. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1682. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1683. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1684. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1685. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1686. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1687. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1688. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1689. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1690. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1691. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1692. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1693. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1694. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1695. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1696. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1697. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1698. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1699. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1700. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1701. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1702. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1703. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1704. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1705. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
aacatccgcatccgcatccgcatccgcatccgca	Protospacer
..********** *********** *********

1706. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1707. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1708. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1709. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1710. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1711. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1712. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1713. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1714. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.882

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcatccgcatccgcatccgcatccgcatccgcc	Protospacer
 *********** *********** ******** 

1715. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatcagca	Protospacer
 *********** ***********.**.

1716. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatcggcgtcagcgtcggca	Protospacer
.***************** **.*****.

1717. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtcggcatcggca	Protospacer
 *********** ***** ********.

1718. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcgtctgcatcagca	Protospacer
.*********** ***********.**.

1719. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatcagca	Protospacer
 *********** ***********.**.

1720. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatctgcgtctgcatctgaa	Protospacer
************ *********** * .

1721. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgagtctgcatctgcgtctgcatctgcg	Protospacer
 * ********* *********** ***

1722. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcagcggcgtctgcagcggca	Protospacer
.********* *********** ****.

1723. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcatcggca	Protospacer
 ***** ********.***********.

1724. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcatctgcatcggcgtcggcatcggca	Protospacer
.**.************** ********.

1725. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgca	Protospacer
 *********** *********** **.

1726. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcgtcggca	Protospacer
 *********** ********.*****.

1727. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcgtcggca	Protospacer
 *********** ********.*****.

1728. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcgtcggca	Protospacer
 *********** ********.*****.

1729. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcgtcggca	Protospacer
 *********** ********.*****.

1730. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtccgcatcggcgtccgcatcggca	Protospacer
.*****.***********.********.

1731. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtccgcatcggcgtccgcatcggca	Protospacer
.*****.***********.********.

1732. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatcggcgtcagcatcgctg	Protospacer
.***************** ****** .*

1733. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtcagcatcggcgtccgcatcggca	Protospacer
.***** ***********.********.

1734. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtccgcatcggcatctgcatcggca	Protospacer
.*****.********.***********.

1735. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MH067975 (Arthrobacter sp. strain ANT_H58 plasmid pA58H2, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
cgcgtcagcaccggcgtctgcatcggag	Protospacer
 ***** ***.*************** *

1736. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
atcggctgcatcggcggctgcatcggcc	Protospacer
* ** *********** ********** 

1737. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatcagcatccgcgtcggcgtcagcatcggca	Protospacer
.********************.******** **.

1738. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1739. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggcatctgcg	Protospacer
 * *************** *****.*********

1740. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1741. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1742. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggcatctgcg	Protospacer
 * *************** *****.*********

1743. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1744. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggcatctgcg	Protospacer
 * *************** *****.*********

1745. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggcatctgcg	Protospacer
 * *************** *****.*********

1746. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1747. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggcatctgcg	Protospacer
 * *************** *****.*********

1748. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1749. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1750. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggcatctgcg	Protospacer
 * *************** *****.*********

1751. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgaatcagcatccgcgtctgcatctgcatctgcg	Protospacer
 * *************** ***** *********

1752. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcatccgcatccgcgtcggcatcagcatccgca	Protospacer
 ***** ***********************.**.

1753. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcatccgcatccgcgtcggcatcagcatccgca	Protospacer
 ***** ***********************.**.

1754. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcatccgcatccgcgtcggcatcagcatccgca	Protospacer
 ***** ***********************.**.

1755. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatcggcatccgcgtcggcatcggcatctgca	Protospacer
.*****.*****************.********.

1756. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.882

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatcggcatccgcgtcggcatcggcatctgca	Protospacer
.*****.*****************.********.

1757. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
** .***********.***********.

1758. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcggcatcggcg	Protospacer
** .**************.**.******

1759. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggcg	Protospacer
** .*****.******** *********

1760. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
** .************** ***** ***

1761. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
** .************** ***** ***

1762. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatccgcgtcggca	Protospacer
 * *************** ********.

1763. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
** .***********.***********.

1764. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
** .***********.***********.

1765. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcggcatcggcg	Protospacer
** .**************.**.******

1766. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggcg	Protospacer
** .*****.******** *********

1767. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
** .************** ***** ***

1768. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
** .************** ***** ***

1769. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgagtcagcatcggcatctgcgtcggca	Protospacer
 ***** *********** ********.

1770. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgagtcagcatcggcatctgcgtcggca	Protospacer
 ***** *********** ********.

1771. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgagtcagcatcggcatctgcgtcggca	Protospacer
 ***** *********** ********.

1772. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgagtcagcatcggcatctgcgtcggca	Protospacer
 ***** *********** ********.

1773. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgagtcagcatcggcatctgcgtcggca	Protospacer
 ***** *********** ********.

1774. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgagtcagcatcggcatctgcgtcggca	Protospacer
 ***** *********** ********.

1775. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggcg	Protospacer
 * *** *********** *********

1776. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatcagcgtcggca	Protospacer
** .** ********************.

1777. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatcagcgtcggca	Protospacer
** .** ********************.

1778. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcgtcagcgtcggcg	Protospacer
** .** ********.************

1779. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatcagcgtcggca	Protospacer
.* *** ********************.

1780. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcgtcggca	Protospacer
** .************** ********.

1781. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatctgcgtcggcg	Protospacer
 * *** *********** *********

1782. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcg	Protospacer
** .******** ***** *********

1783. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcg	Protospacer
** .******** ***** *********

1784. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcatcggcg	Protospacer
** .************** **.******

1785. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcatcggcg	Protospacer
** .***********.*****.******

1786. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcatcggcg	Protospacer
** .************** **.******

1787. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtccgcatcggcatccgcgtcggca	Protospacer
.* *************** ********.

1788. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtccgcatcggcatccgcgtcggca	Protospacer
.* *************** ********.

1789. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtccgcatcggcatcggcgtcagcg	Protospacer
.* ***************.*****.***

1790. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatctgcgtcggcg	Protospacer
 * *** *********** *********

1791. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatctgcgtcggcg	Protospacer
 * *** *********** *********

1792. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtccgcatcggcatccgcgtcagcg	Protospacer
.* *************** *****.***

1793. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcatcggcg	Protospacer
** .***********.*****.******

1794. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtcggca	Protospacer
** .************** ********.

1795. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcgtcagcgtcagcg	Protospacer
 * ************.********.***

1796. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatctgcgtccgcg	Protospacer
 * *************** ***** ***

1797. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatctgcgtccgcg	Protospacer
 * *************** ***** ***

1798. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatctgcgtccgcg	Protospacer
 * *************** ***** ***

1799. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatctgcgtccgcg	Protospacer
 * *************** ***** ***

1800. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatcagcatcggcg	Protospacer
 * *** **************.******

1801. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
** .***********.***********.

1802. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatcggcgtcggcg	Protospacer
 * *** ***********.*********

1803. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtcagcg	Protospacer
** .************** *****.***

1804. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcgtcggcatcatcgtcggcg	Protospacer
 * ******.********* ********

1805. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcagcatcggcatccgcgtcggcg	Protospacer
.* *** *********** *********

1806. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcgtcagcgtctgcg	Protospacer
 * ************.******** ***

1807. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcagcatcggcatccgcgtcggcg	Protospacer
 * *** *********** *********

1808. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcagcgtccgca	Protospacer
** .******************** **.

1809. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcagcgtccgca	Protospacer
** .******************** **.

1810. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcgtctgcg	Protospacer
** .************** ***** ***

1811. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 4, identity: 0.857

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
cgcgtcggcatccgcatcagcatcggcg	Protospacer
 ***** ************* ***** *

1812. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtccgcgtcggca	Protospacer
.* *************** ******* *

1813. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcggcgtcggca	Protospacer
 * ***************.******* *

1814. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatcggcgtcagcgtcggca	Protospacer
 * ********* ************* *

1815. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcggcatccgcgtcagcgtcggca	Protospacer
 * *** ******************* *

1816. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
tgcatccgcatcagcgtcagcgtcggca	Protospacer
 * ********* ************* *

1817. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.* ********* ************* *

1818. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagca	Protospacer
 * *********************.* *

1819. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagca	Protospacer
 * *********************.* *

1820. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.* ********* ************* *

1821. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.* ********* ************* *

1822. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagca	Protospacer
 * *********************.* *

1823. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.* ********* ************* *

1824. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtctgcgtccgca	Protospacer
** *************** ***** * *

1825. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
agcatccgcatccgcgtctgcgtccgca	Protospacer
** *************** ***** * *

1826. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.857

cgcg-tcggaatcggaatcggaatcggca	CRISPR spacer
-gcgaccggaatcggaatcggaatcgggg	Protospacer
 *** .********************* .

1827. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.882

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
ggcatccgcatcggcgtcagcatcggcgtcggca	Protospacer
 ******************* *********.**.

1828. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.882

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
ggcatccgcatcggcgtcagcatcggcgtccgca	Protospacer
 ******************* ********* **.

1829. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
agagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
 * ******************************.**.***

1830. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
agagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
 * ******************************.**.***

1831. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
agagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
 * ******************************.**.***

1832. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
agagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
 * ******************************.**.***

1833. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
agagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
 * ******************************.**.***

1834. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
agagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
 * ******************************.**.***

1835. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.9

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
tgagtcagagtcagagtcagagtcagagtcagagtcagag	Protospacer
.* ******************************.**.***

1836. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgaatcagcatctgcatctgcgtctgaa	Protospacer
 * *** *********** *********

1837. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgaatcagcatctgcatctgcgtctgaa	Protospacer
 * *** *********** *********

1838. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcatccgcgtcggca	Protospacer
************ ***** ***** * *

1839. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1840. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcatccgcgtcggca	Protospacer
************ ***** ***** * *

1841. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcatctgcgtccgca	Protospacer
************ ***** *****.* *

1842. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatcagcatccgcatcagcgtcggca	Protospacer
****** *****.*********** * *

1843. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcagcatctgcatcagcatctgca	Protospacer
 ***** **************.**** *

1844. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1845. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1846. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1847. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatcagcgtccgca	Protospacer
.*********** ***********.* *

1848. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatcagcgtccgca	Protospacer
.*********** ***********.* *

1849. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatcagcatctgcatcggcgtccgca	Protospacer
****** ***********.*****.* *

1850. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatctgcgtcagcatcggca	Protospacer
***************.*****.** * *

1851. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatctgcatcggcatccgca	Protospacer
******************.**.**.* *

1852. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcagcatctgcatcagcatctgca	Protospacer
 ***** **************.**** *

1853. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1854. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1855. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1856. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatccgcatccgcgtcggca	Protospacer
************.***** ***** * *

1857. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.857

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
************ **.******** * *

1858. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to CP003676 (Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence) position: , mismatch: 5, identity: 0.853

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcagcatcagcgtcggcatcagcg	Protospacer
.* ********* *********** ******* *

1859. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatccgcg	Protospacer
 *********** * *********** .

1860. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcatcggcatccgcatccgcatccgcg	Protospacer
 **.********** *********** .

1861. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcatcggcatccgcatccgcatccgcg	Protospacer
 **.********** *********** .

1862. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatccgcg	Protospacer
.************* *** ******* .

1863. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatcagcatccgcatcggcg	Protospacer
************ * ********* * .

1864. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
.************* *** ***** * *

1865. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
.************* *** ***** * *

1866. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggca	Protospacer
 *********** * ********* * *

1867. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatccgcatcggcg	Protospacer
.************* ********* * .

1868. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcatcggcatccgcatccgcatccgcg	Protospacer
.**.********** *********** .

1869. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcatcggcg	Protospacer
 ************* ********* * .

1870. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcgtcagca	Protospacer
 ************* ******.** * *

1871. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcggca	Protospacer
.************* *** ***** * *

1872. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcatcggcatccgcatccgcatcggca	Protospacer
.**.********** ********* * *

1873. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatccgcgtcggca	Protospacer
 ************* ******.** * *

1874. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatccgcg	Protospacer
.************* *** ******* .

1875. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcagcatccgcatccgcatccgcg	Protospacer
 *****.******* *********** .

1876. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatcagcatctgcg	Protospacer
************** *** *****.* .

1877. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatcggcatctgcg	Protospacer
************** *** *****.* .

1878. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcg	Protospacer
************** ******.** * .

1879. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcggca	Protospacer
.************* *** ***** * *

1880. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
.************* *** ***** * *

1881. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcagcatccgcatccgcatccgcg	Protospacer
 *****.******* *********** .

1882. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatcagcatccgcatcggcg	Protospacer
************ * ********* * .

1883. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatcagcatccgcatcggcg	Protospacer
************ * ********* * .

1884. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcagcatccgcg	Protospacer
 ************* *** ******* .

1885. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcagcatccgcatccgcatccgcg	Protospacer
 *****.******* *********** .

1886. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatccgcg	Protospacer
.************* *** ******* .

1887. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcagcatccgcatccgcatccgcg	Protospacer
 *****.******* *********** .

1888. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatcagcatctgcg	Protospacer
************** *** *****.* .

1889. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatcggcatctgcg	Protospacer
************** *** *****.* .

1890. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcg	Protospacer
************** ******.** * .

1891. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcg	Protospacer
************** ******.** * .

1892. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcggca	Protospacer
.************* *** ***** * *

1893. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtcggcatccgcatcggcatcagca	Protospacer
.************* *** ***** * *

1894. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to MK359329 (Mycobacterium phage Kamryn, complete genome) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgagtccgcatccgagtccgcatccgag	Protospacer
 * *** ********.***********.

1895. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to MK359329 (Mycobacterium phage Kamryn, complete genome) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgagtccgcatccgagtccgcatccgag	Protospacer
 * *** ********.***********.

1896. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatcggcatcggca	Protospacer
 ***********.***** ***** * *

1897. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatcggcatcggca	Protospacer
 ***********.***** ***** * *

1898. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatcggcatcggca	Protospacer
 ***********.***** ***** * *

1899. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatcggcatcggca	Protospacer
 ***********.***** ***** * *

1900. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
gtcgtcggcatcggcatcggcatcggcatcggca	Protospacer
* *.************** *****.********.

1901. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaga	Protospacer
****************** *****.******. .

1902. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ttcatcggcatcggcatcggcatcggcatcggca	Protospacer
  **************** *****.********.

1903. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ttcatcggcatcggcatcggcatcggcatcggca	Protospacer
  **************** *****.********.

1904. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ttcatcggcatcggcatcggcatcggcatcggca	Protospacer
  **************** *****.********.

1905. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaat	Protospacer
****************** *****.******.  

1906. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaat	Protospacer
****************** *****.******.  

1907. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaat	Protospacer
****************** *****.******.  

1908. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 5, identity: 0.853

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
aacttcagcgtcagcgtcagcgtcagcgtcagcg	Protospacer
 .* ** **.************************

1909. spacer 3.15|3323154|46|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.891

ggagtcggcatccgcatcggcgtcagcgtccgcatcagcgtctgca	CRISPR spacer
agcatcggcatccgcatcggcatcagcgtccgcatcagcgtcagca	Protospacer
.* .*****************.******************** ***

1910. spacer 3.15|3323154|46|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.891

ggagtcggcatccgcatcggcgtcagcgtccgcatcagcgtctgca	CRISPR spacer
cgcatcggcatccgcatcggcatcagcgtccgcatcagcgtcagca	Protospacer
 * .*****************.******************** ***

1911. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaat	Protospacer
************ ***********..  

1912. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtgtcggcatcggcatcggcatcggca	Protospacer
 *..******** ***********.***

1913. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1914. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaat	Protospacer
************ ***********..  

1915. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaat	Protospacer
************ ***********..  

1916. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcaggcgcc	Protospacer
************ *********   ** 

1917. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1918. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1919. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1920. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1921. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1922. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatcggcatcggcatcggca	Protospacer
 *. ******** ***********.***

1923. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcatcgcgc	Protospacer
************ ***********.   

1924. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatccgcatccgcatccgcatccaca	Protospacer
 ***** *********** ***** .**

1925. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ctcctcgccgtccgcatcggcatcagca	Protospacer
  * *** *.******************

1926. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcgccgcca	Protospacer
************ ********..*. **

1927. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggtatcggcatcggcatcggcatcggtg	Protospacer
**.********* ***********.*..

1928. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP018857 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcgccatcgtcg	Protospacer
************ ****** ****. *.

1929. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP018857 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
accatcggcatcggcatcggcatcgcca	Protospacer
. ********** ***********. **

1930. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gccatcggcatcggcatcggcatcgacg	Protospacer
* ********** ***********..*.

1931. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP017579 (Sphingomonas melonis TY plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatccgcatccgcatcacca	Protospacer
 *. ************** ****** **

1932. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP017579 (Sphingomonas melonis TY plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtttcggcatccgcatccgcatcacca	Protospacer
 *. ************** ****** **

1933. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP015734 (Arthrobacter sp. U41 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcattggcatcggcatcggcatcggtg	Protospacer
*****.****** ***********.*..

1934. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcggcatcagcgtcggcatcgaca	Protospacer
.*********** **.********..**

1935. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcaccggcatccgcaccggcatccaca	Protospacer
 ***.***********.******* .**

1936. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_009936 (Pseudomonas phage LKA1, complete genome) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gacgtcggcatcggcagcggcatcagcg	Protospacer
*.*.******** *** **********.

1937. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to AM265639 (Pseudomonas phage LKA1 complete genome, specific host Pseudomonas aeruginosa) position: , mismatch: 5, identity: 0.821

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gacgtcggcatcggcagcggcatcagcg	Protospacer
*.*.******** *** **********.

1938. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatccgca	Protospacer
 *********** ************* *** * *

1939. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcggcatccgcatccgcgtcggcatctgca	Protospacer
 *********** ************* *** * *

1940. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatcggcg	Protospacer
 *********** ************* ***** .

1941. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatccgca	Protospacer
 *********** ************* *** * *

1942. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatcggcg	Protospacer
 *********** ************* ***** .

1943. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggcatccgca	Protospacer
 *********** ************* *** * *

1944. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatccgcatcagcatccgcgtcggcatcagca	Protospacer
.***** ******************* ***.* *

1945. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatccgca	Protospacer
 *********** ************* *** * *

1946. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ctgatccgcatcggcatccgcgtcggcatccgcg	Protospacer
   ******************.***********.

1947. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
agcatccgcatcggcgtccgcgtcggcatccgtc	Protospacer
.**************.*****.**********. 

1948. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaga	Protospacer
****** *********** *********** . *

1949. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgggt	Protospacer
****** *********** *********** *  

1950. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cggcgt-cgcatcggcatctgcgtcggcatccgcg	Protospacer
 ***.* ************.**.***********.

1951. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgccc	Protospacer
****** *********** ***********  * 

1952. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcggcatc-cgca	CRISPR spacer
ggtttcggcatcggcatcggcatcggcatcgcgc-	Protospacer
**. ** *********** *********** *** 

1953. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.853

ggcatccgcatcggcatccgcatcgg-catccgca	CRISPR spacer
ggcttccgcatcggcctccgcatcggatatccgg-	Protospacer
*** *********** ********** .*****  

1954. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcatctgaa	Protospacer
 *********** *********** * .

1955. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcatctgcgtctgcgtctgag	Protospacer
 *********** ********.** * *

1956. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcgtctgcgtctgcatctgag	Protospacer
 ********.** *********** * *

1957. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcgtctgcgtctgcatctgag	Protospacer
 ********.** *********** * *

1958. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcgtcggcatctgcatcggcg	Protospacer
 * .*****.*****.************

1959. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcatctgag	Protospacer
 ***** ********.******** * *

1960. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcatctgag	Protospacer
 ***** ********.******** * *

1961. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgcgtcagcgtctgcatctgag	Protospacer
 ********.**.*********** * *

1962. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1963. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1964. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1965. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1966. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1967. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1968. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcggctgcatcggcggctgcatcgggt	Protospacer
.*** *********** *********  

1969. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaggtcttcatcggcgtcttcatcggcg	Protospacer
.. **** *********** ********

1970. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
cgtgtcagcatcggcgtctgcgtcggcc	Protospacer
 *.*** **************.***** 

1971. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcatctgcatccgtg	Protospacer
.*********** **.******** *.*

1972. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcatctgcatccgtg	Protospacer
.*********** **.******** *.*

1973. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcatctgcatccgtg	Protospacer
.*********** **.******** *.*

1974. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcgtctgcatctgcatctgcatccgtg	Protospacer
.*********** **.******** *.*

1975. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.853

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
ggcatcagcatccgcatcggcgtcagcatcaccg	Protospacer
.**************.*****.********  **

1976. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

1977. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

1978. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

1979. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatccgcgtcggca	Protospacer
 * *** *********** ********.

1980. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcgtcagcgtcggca	Protospacer
 * *** ********.***********.

1981. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatccgcgtcggca	Protospacer
 * *** *********** ********.

1982. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

1983. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

1984. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggca	Protospacer
** .*****.******** ********.

1985. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggca	Protospacer
** .*****.******** ********.

1986. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
** .*****************.** **.

1987. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgca	Protospacer
** .************** ***** **.

1988. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcagca	Protospacer
** .***********.********.**.

1989. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcatcggca	Protospacer
** .************** **.*****.

1990. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

1991. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

1992. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

1993. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatccgcgtcggca	Protospacer
 * *** *********** ********.

1994. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcgtcagcgtcggca	Protospacer
 * *** ********.***********.

1995. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcgtcagcgtcggca	Protospacer
 * *** ********.***********.

1996. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcgtcggcatcggcatccgcgtcggca	Protospacer
 * *** *********** ********.

1997. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

1998. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

1999. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggca	Protospacer
** .*****.******** ********.

2000. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggca	Protospacer
** .*****.******** ********.

2001. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
** .*****************.** **.

2002. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgca	Protospacer
** .************** ***** **.

2003. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcgtcagca	Protospacer
** .***********.********.**.

2004. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcgtcggcatctgcgtcggcg	Protospacer
.* .*****.******** *********

2005. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2006. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2007. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2008. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2009. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2010. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2011. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2012. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2013. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2014. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2015. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2016. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2017. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2018. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2019. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcatctgcgtcggca	Protospacer
.* *** *********** ********.

2020. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2021. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcgtcggcatctgcgtcggcg	Protospacer
.* .*****.******** *********

2022. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatctgcatcggcatctgcgtcggca	Protospacer
** .**.*********** ********.

2023. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtcggca	Protospacer
** .** *********** ********.

2024. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtcggca	Protospacer
** .** *********** ********.

2025. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2026. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2027. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2028. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2029. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcgtcagcgtcggca	Protospacer
.* *** ********.***********.

2030. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcggcatcggcatctgcgtcggca	Protospacer
 * *** *********** ********.

2031. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcgtcggcatcggcgtcagcgtcggca	Protospacer
.* *** ********.***********.

2032. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2033. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2034. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2035. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 * .** ***** ***************

2036. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcatccgcgtcggca	Protospacer
.* .************** ********.

2037. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

2038. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcatccgcgtcggca	Protospacer
.* .************** ********.

2039. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatcggcgtcagcgtcggca	Protospacer
 * .***********.***********.

2040. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatccgcatccgcgtcggcg	Protospacer
 * .******** ***** *********

2041. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatcggcatccgcgtcggcg	Protospacer
 * .** *********** *********

2042. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatcggcatctgcatcggcg	Protospacer
 * .************** **.******

2043. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtcagcatcggcatcggcgtcggca	Protospacer
 * *** ***********.********.

2044. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcatccgcgtcagcg	Protospacer
.* .************** *****.***

2045. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtccgcgtcggcg	Protospacer
.* .***********.** *********

2046. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
** .*****************.** **.

2047. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
** .******** ***** ********.

2048. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
** .******** ***** ********.

2049. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
** .*****************.** **.

2050. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
** .******** ***** ********.

2051. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatctgcatcggcgtcagcgtcggca	Protospacer
** .**.********.***********.

2052. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcgtcagcgtcggca	Protospacer
** .** ********.***********.

2053. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
** .******** ***** ********.

2054. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatctgcatcggcatccgcgtcggca	Protospacer
** .**.*********** ********.

2055. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtcagcgtcggca	Protospacer
.* .***********.***********.

2056. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcatcggcatcggcg	Protospacer
.* .**************.**.******

2057. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcagcatcggcgtcagcgtcggca	Protospacer
** .** ********.***********.

2058. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcgtcggcatcagcgtcggca	Protospacer
 * .*****.*****************.

2059. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtccgcgtcggcg	Protospacer
.* .***********.** *********

2060. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtccgcgtcggcg	Protospacer
.* .***********.** *********

2061. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatctgcatcggcgtcggca	Protospacer
 * ********* *****.********.

2062. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatcggcgtccgcgtcggcg	Protospacer
 * .***********.** *********

2063. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatctgcatcggcgtcggca	Protospacer
 * ********* *****.********.

2064. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatccgcatcagcgtcagcg	Protospacer
 * .******** ***********.***

2065. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatcggcatcggca	Protospacer
** .**************.**.*****.

2066. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtcggca	Protospacer
** .** *********** ********.

2067. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatctgcgtccgca	Protospacer
** .************** ***** **.

2068. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcagcatcggcgtcagcgtcggca	Protospacer
** .** ********.***********.

2069. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
** .******** ***** ********.

2070. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcgtcagcatcggca	Protospacer
** .***********.*****.*****.

2071. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatctgcatcggcatccgcgtcggca	Protospacer
** .**.*********** ********.

2072. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatctgcatcggcatccgcgtcggca	Protospacer
** .**.*********** ********.

2073. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gagatccgcatcggcatccgcgtctgcg	Protospacer
*...************** ***** ***

2074. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcgtccgcatcggcatcagcatccgca	Protospacer
 * ******************.** **.

2075. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatctgcatcagcatcagcgtcggcg	Protospacer
 * .**.*****.***************

2076. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcggcatccgcatcggca	Protospacer
** .************** **.*****.

2077. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggca	Protospacer
** .*****.******** ********.

2078. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcagcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

2079. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

2080. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcgtcggcatccgcgtcggca	Protospacer
** .*****.******** ********.

2081. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcagcatcggcatccgcgtcggca	Protospacer
** .** *********** ********.

2082. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatccgcatcagcatccgcgtcggca	Protospacer
** .********.***** ********.

2083. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ctggtccgcatcggcatcgccgtcggcg	Protospacer
  .***************. ********

2084. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ctggtccgcatcggcatcgccgtcggcg	Protospacer
  .***************. ********

2085. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgggtccgcatcggcatccacgtcggca	Protospacer
 *.*************** .*******.

2086. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gccgtcagcatcggcaccagcgtcggca	Protospacer
*  *** *********.**********.

2087. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to CP003676 (Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatcggcatcagcatcagcgtcggca	Protospacer
** .** *****.**************.

2088. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to LR606150 (Rhizobium sp. Q54 genome assembly, plasmid: 7) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggtacccgcatcgccatcatcgtcggcg	Protospacer
** ..******** ***** ********

2089. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2090. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2091. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2092. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2093. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2094. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2095. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcctgcgcatcggcatcggcgtcggct	Protospacer
**  * ************.******** 

2096. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2097. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2098. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 5, identity: 0.821

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggcatgcgcatcggcatcggcgtcggct	Protospacer
** .* ************.******** 

2099. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
agcgtcggcatccgcatcagcatctgcg	Protospacer
.***** ************* *** * *

2100. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
agcgtcggcatccgcatcagcatctgcg	Protospacer
.***** ************* *** * *

2101. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcgtccgcatcagcatcagcatcagca	Protospacer
************ ******* ***.* .

2102. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
tgcgtccgcatctgcatcagcatccgcg	Protospacer
 ***********.******* *** * *

2103. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
cgcgtcggcatccgcatcagcatccgcg	Protospacer
 ***** ************* *** * *

2104. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
.* ********* ************* .

2105. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagcg	Protospacer
 * *********************.* .

2106. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcgtcagcgtcagcgtcggca	Protospacer
 * ******.** ************* *

2107. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcagcatcggcgtcagcgtcggca	Protospacer
.* *** ***** ************* *

2108. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.* ************.** ******* *

2109. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.* ************.** ******* *

2110. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcggcgtccgca	Protospacer
 * ***************.***** * *

2111. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggca	Protospacer
 * ************.** ******* *

2112. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.* ************.** ******* *

2113. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcggcgtccgca	Protospacer
 * ***************.***** * *

2114. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatctgcatcggcgtcagcgtcggca	Protospacer
.* ***.***** ************* *

2115. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggca	Protospacer
 * ************.** ******* *

2116. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatctgcatccgcgtcggcgtcggca	Protospacer
.* ***.***********.******* *

2117. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcggcatcggcgtcagcgtcggca	Protospacer
.* *** ***** ************* *

2118. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.* ************.** ******* *

2119. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatctgcatccgcgtcggcgtcggca	Protospacer
.* ***.***********.******* *

2120. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
.* ********* ************* .

2121. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
tgcatctgcatccgcgtcggcgtcggca	Protospacer
 * ***.***********.******* *

2122. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcagca	Protospacer
.* ********* ***********.* *

2123. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcggcatccgcgtcggcgtcggca	Protospacer
 * *** ***********.******* *

2124. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcagcatcggcgtcagcgtcggca	Protospacer
 * *** ***** ************* *

2125. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcggcgtcagca	Protospacer
.* ***************.*****.* *

2126. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
tgcatctgcatccgcgtcggcgtcggca	Protospacer
 * ***.***********.******* *

2127. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
.* ********* ************* .

2128. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
tgcatctgcatccgcgtcggcgtcggca	Protospacer
 * ***.***********.******* *

2129. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatcggcgtccgcgtcggca	Protospacer
 * ********* ***** ******* *

2130. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcggcgtccgca	Protospacer
.* ***************.***** * *

2131. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcagca	Protospacer
.* ********* ***********.* *

2132. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcggcatccgcgtcggcgtcggca	Protospacer
 * *** ***********.******* *

2133. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcagcatcggcgtcagcgtcggca	Protospacer
 * *** ***** ************* *

2134. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcggcgtcagca	Protospacer
.* ***************.*****.* *

2135. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcggcgtcggcg	Protospacer
.* ***************.******* .

2136. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcagcatctgca	Protospacer
.* ******************.** * *

2137. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcagcatctgca	Protospacer
 * ******************.** * *

2138. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcagcatcggcgtcagcgtcggca	Protospacer
.* *** ***** ************* *

2139. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.* ************.** ******* *

2140. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcgtcggcatcggca	Protospacer
 * ***************.**.**** *

2141. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcgtcagcgtcagcgtcggca	Protospacer
.* ******.** ************* *

2142. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcatcggca	Protospacer
.* ********* ********.**** *

2143. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatcggcgtcagcgtcagca	Protospacer
 * ********* ***********.* *

2144. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcggcatctgcgtcagcgtcggca	Protospacer
 * *** *****.************* *

2145. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcagcgtcagcatcggca	Protospacer
.* ********* ********.**** *

2146. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
tgcatcagcatccgcgtcagcatcggca	Protospacer
 * *** **************.**** *

2147. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcagcatccgcgtcagcatcggca	Protospacer
.* *** **************.**** *

2148. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NZ_CP017756 (Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cgcg-tcggaatcggaatcggaatcggca	CRISPR spacer
-gtgttcggtatcggaatcggaatcgact	Protospacer
 *.* **** ****************.* 

2149. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 5, identity: 0.821

cgcgtcggaatcggaatcggaatcggca	CRISPR spacer
ctggccggaatcggaatcgggattggca	Protospacer
*  *.***************.**.****

2150. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 5, identity: 0.821

cgcgtcggaatcggaatcggaatcggca	CRISPR spacer
ctggccggaatcggaatcgggattggca	Protospacer
*  *.***************.**.****

2151. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.875

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
ggcatcggcatctgcatcggcatctgcgtcggcatctgca	Protospacer
 ***** ********************.******** * *

2152. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.875

cgcatctgcatctgcatcggcatctgca----tcggcatcagaa	CRISPR spacer
cgcatcggcatctgcatcggcatctgcatcgctcggcatc----	Protospacer
****** *********************    ********    

2153. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.875

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatctgcatcggcgtccgcatcagcatcagcatcagca	Protospacer
************************ ******* ***.* .

2154. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatctgcgtcagcatctgcg	Protospacer
.**************.*****.**** .

2155. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatcggcatccgcgtcagcg	Protospacer
************ ***** ***** * .

2156. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatctgcatccgcatcagcgtcagcg	Protospacer
******.*****.*********** * .

2157. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
.*********** ********.**.* *

2158. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.***********.***** ***** * *

2159. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.***********.***** ***** * *

2160. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggca	Protospacer
 ***********.***** ***** * *

2161. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
.*********** ********.**.* *

2162. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.***********.***** ***** * *

2163. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatcagcatcggca	Protospacer
 ***** **************.** * *

2164. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatcggcgtcagcgtcggca	Protospacer
 *********** **.******** * *

2165. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggca	Protospacer
 ***** *********** ***** * *

2166. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatccgcgtcggca	Protospacer
.*********** ***** ***** * *

2167. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggca	Protospacer
 ***** *********** ***** * *

2168. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggca	Protospacer
 ***** *********** ***** * *

2169. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggca	Protospacer
 ***********.***** ***** * *

2170. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.***********.***** ***** * *

2171. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatccgcatcagcgtcagcgtcggca	Protospacer
 *********** **.******** * *

2172. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatccgcatccgcgtcagcg	Protospacer
************.***** ***** * .

2173. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatctgcatccgcgtcggca	Protospacer
.***** *********** ***** * *

2174. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
.*********** ********.**.* *

2175. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgca	Protospacer
.*********** ***** *****.* *

2176. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggca	Protospacer
 ***** *********** ***** * *

2177. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.*********** **.******** * *

2178. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcagca	Protospacer
.*********** **.******** * *

2179. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagca	Protospacer
 ***********.**.******** * *

2180. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatccgcgtctgcg	Protospacer
.*********** ***** ******* .

2181. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatcagcatctgcatccgcgtcggcg	Protospacer
****** *********** ***** * .

2182. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcgtctgcgtcagcgtcagca	Protospacer
.********.*****.******** * *

2183. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatctgcatctgcatctgcgtcggca	Protospacer
 *****.*********** ***** * *

2184. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcgtctgcatctgcgtcagca	Protospacer
.********.******** ***** * *

2185. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatcggcgtccgca	Protospacer
.***** ***********.*****.* *

2186. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatctgcatctgcatctgcgtctgcg	Protospacer
 *****.*********** ******* .

2187. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatctgcatctgcatctgcgtctgcg	Protospacer
 *****.*********** ******* .

2188. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2189. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2190. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2191. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2192. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2193. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2194. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2195. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2196. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2197. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2198. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2199. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2200. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2201. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2202. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2203. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatcagcgtcggcg	Protospacer
 ***** ***************** * .

2204. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatcagcatctgcatctgcgtcggcg	Protospacer
****** *********** ***** * .

2205. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatcagcatctgcatctgcgtcggcg	Protospacer
****** *********** ***** * .

2206. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2207. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatctgcatctgcgtcggca	Protospacer
.***** *********** ***** * *

2208. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatcggcatcagcgtcggca	Protospacer
.***** ***** *********** * *

2209. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatcggcatcagcgtcggca	Protospacer
.***** ***** *********** * *

2210. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcatcagcgtcagcg	Protospacer
 ***********.*********** * .

2211. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtcggca	Protospacer
.*********** ***** ***** * *

2212. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcagca	Protospacer
.***********.***** ***** * *

2213. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgca	Protospacer
.*********** ***** *****.* *

2214. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcgtccgcatctgcatcggcgtcggca	Protospacer
 **.**************.***** * *

2215. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcgtcggcatcagcgtcggca	Protospacer
 ********.** *********** * *

2216. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcgtccgcatctgcatcggcgtcggca	Protospacer
 **.**************.***** * *

2217. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatcggcgtcagca	Protospacer
.***********.*****.***** * *

2218. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.*********** **.******** * *

2219. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggca	Protospacer
.***********.***** ***** * *

2220. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatctgcatcggcgtcagca	Protospacer
.***** ***********.***** * *

2221. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatcggcgtcagcgtcagca	Protospacer
 *********** **.******** * *

2222. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcgtcagcgtcggca	Protospacer
 ***** ********.******** * *

2223. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatccgcatccgcgtcagcg	Protospacer
************.***** ***** * .

2224. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatctgcatccgcgtcggca	Protospacer
.***** *********** ***** * *

2225. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatcagcatccgca	Protospacer
.*********** ********.**.* *

2226. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgca	Protospacer
.*********** ***** *****.* *

2227. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatccgcgtcggca	Protospacer
 ***** *********** ***** * *

2228. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.*********** **.******** * *

2229. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcgtccgcatctgcatccgcgtcggca	Protospacer
.**.************** ***** * *

2230. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggca	Protospacer
.*********** **.******** * *

2231. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcagca	Protospacer
.*********** **.******** * *

2232. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagca	Protospacer
 ***********.**.******** * *

2233. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatcagcatctgcg	Protospacer
.*********** ********.**** .

2234. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcagcatcagcatcagcgtcagca	Protospacer
.***** ***** *********** * *

2235. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to MN369757 (Streptomyces phage Bordeaux, complete genome) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
catatctgcatctgcatcagcgtatgaa	Protospacer
 ..***.**************** ****

2236. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to MN484599 (Streptomyces phage Wipeout, complete genome) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
catatctgcatctgcatcagcgtatgaa	Protospacer
 ..***.**************** ****

2237. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to MK801722 (Streptomyces phage Birchlyn, complete genome) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
catatctgcatctgcatcagcgtatgaa	Protospacer
 ..***.**************** ****

2238. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to MN369750 (Streptomyces phage TomSawyer, complete genome) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
catatctgcatctgcatcagcgtatgaa	Protospacer
 ..***.**************** ****

2239. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to MH576964 (Streptomyces phage Starbow, complete genome) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
catatctgcatctgcatcagcgtatgaa	Protospacer
 ..***.**************** ****

2240. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatctgcatccgcatccgca	Protospacer
.***************** **.**.* *

2241. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcggca	Protospacer
 ***********.**.******** * *

2242. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
agcatccgcatccgcatccgcgtcagcg	Protospacer
************.***** ***** * .

2243. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagca	Protospacer
 ***********.**.******** * *

2244. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatccgcgtcggca	Protospacer
.*********** ***** ***** * *

2245. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcagccgcttctgcatcagcgtcagca	Protospacer
 *** **** ************** * *

2246. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to CP003676 (Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence) position: , mismatch: 5, identity: 0.821

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatcagcatcagcgtcggca	Protospacer
.***** ***** *********** * *

2247. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
gcaatgattccgctgctggcgctgg-gtattcc	Protospacer
*.****.***** ************ **** * 

2248. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatcggcgtcggcatcagca	Protospacer
** .**************.***** ******* .

2249. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcgtcagcgtcggcatcggcg	Protospacer
 * ************.******** *****.* *

2250. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcggcgtcagcatctgcg	Protospacer
 * ***************.***** ***** * *

2251. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatcggcgtcagcatcggcg	Protospacer
** .**************.***** *****.* *

2252. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatccgcgtcggcatcagcg	Protospacer
 * .************** ***** ******* *

2253. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcagcatctgcgtccgcg	Protospacer
 * ******************.*****.** * *

2254. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatccgcatcagcatcagcatctgcg	Protospacer
.* ******************.** ***** * *

2255. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcggcatcggcgtctgcatctgcg	Protospacer
.* ********* *****.*********** * *

2256. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcggcatcggcgtctgcatctgcg	Protospacer
.* ********* *****.*********** * *

2257. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcggcatcggcgtctgcatctgcg	Protospacer
.* ********* *****.*********** * *

2258. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatctgcg	Protospacer
 * *************** ***** ***** * *

2259. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcagcatctgcgtccgcg	Protospacer
 * ******************.*****.** * *

2260. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatcggcg	Protospacer
 * *************** ***** *****.* *

2261. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcagcatctgcgtccgcg	Protospacer
 * ******************.*****.** * *

2262. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatcagcatctgcgtccgcg	Protospacer
** .*****************.*****.** * *

2263. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcatccgcg	Protospacer
** .************** ***** ***** * *

2264. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatcggcgtcagcatctgcg	Protospacer
** .**************.***** ***** * *

2265. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatctgcg	Protospacer
 * *************** ***** ***** * *

2266. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatctgcg	Protospacer
 * *************** ***** ***** * *

2267. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcagcatctgcgtccgcg	Protospacer
 * ******************.*****.** * *

2268. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatcggcg	Protospacer
 * *************** ***** *****.* *

2269. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcagcatctgcgtccgcg	Protospacer
 * ******************.*****.** * *

2270. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatcagcatctgcgtccgcg	Protospacer
** .*****************.*****.** * *

2271. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcatccgcg	Protospacer
** .************** ***** ***** * *

2272. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatctgcatccgcatcggcg	Protospacer
 ***********.* ********* * .

2273. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcg	Protospacer
 *********** * ********* * .

2274. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatctgcatccgcatcggcg	Protospacer
 ***********.* ********* * .

2275. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcatcggcatccgcatccgcatcggcg	Protospacer
.**.********** ********* * .

2276. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcg	Protospacer
 *********** * ********* * .

2277. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcg	Protospacer
 *********** * ********* * .

2278. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatccgcatcggcatctgcg	Protospacer
 ************* *** *****.* .

2279. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatctgcg	Protospacer
 *********** * *********.* .

2280. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 ************* *** *****.* .

2281. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcg	Protospacer
 *********** * ********* * .

2282. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 ************* *** *****.* .

2283. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 ************* *** *****.* .

2284. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcg	Protospacer
 *********** * ********* * .

2285. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatctgcatccgcatctgcg	Protospacer
 ***********.* *********.* .

2286. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatctgcatccgcatctgcg	Protospacer
 ***********.* *********.* .

2287. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 ************* *** *****.* .

2288. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcggcatctgcg	Protospacer
 ************* *** *****.* .

2289. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
ggcgtccgcatccgcatccgcatcggcg	Protospacer
.***** ******* ********* * .

2290. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
cgcgtcggcatccgcatcagcatcggcg	Protospacer
 ************* *** ***** * .

2291. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatctgcatctgcg	Protospacer
 ***********.*****.*****.* .

2292. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatctgcatctgcg	Protospacer
 ***********.*****.*****.* .

2293. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
tgcgtcggcatctgaatctgcatctgcg	Protospacer
 ***********.*****.*****.* .

2294. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2295. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtgtcggcatcggcatcggcatcggcatcggca	Protospacer
 *..************** *****.********.

2296. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtctgagtctgag	Protospacer
*********************.** * .** * *

2297. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatctgcgtctgagtctgag	Protospacer
*********************.** * .** * *

2298. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcaaagatg	Protospacer
****************** *****.***  *..*

2299. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcaaagatg	Protospacer
****************** *****.***  *..*

2300. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcaaagatg	Protospacer
****************** *****.***  *..*

2301. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgca----tcagcatcggcg	CRISPR spacer
ggcatctgcatcggcatctgcatcgctcggcatc----	Protospacer
****** ***************    **.*****    

2302. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcggagccg	Protospacer
****************** *****.**.  * **

2303. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2304. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2305. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2306. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2307. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2308. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgtttcggcatcggcatcggcatcggcatcggcc	Protospacer
 *. ************** *****.******** 

2309. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccggggag	Protospacer
****************** *****.**   ** *

2310. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 6, identity: 0.824

tgcatct-gcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
-gcatccaacttcagcgtcagcgtcaacttcagcg	Protospacer
 *****. .* ***************.* ******

2311. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 6, identity: 0.824

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tgcatctgcatcagcgtccgcatcagattcctcg	Protospacer
****************** **.****  **  **

2312. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2313. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tcgctcggcatccgcatcggcgtcggca	Protospacer
    *****************.**.***

2314. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcgtccgcgtcggcatccgtc	Protospacer
 ********.*****.******** *. 

2315. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gtgctcggcatctgcatcggaatcagcc	Protospacer
*   ********.******* ****** 

2316. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2317. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgtatcggcatcggcatcggcatcgggc	Protospacer
 *.********* ***********.*  

2318. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2319. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgtatcggcatcggcatcggcatcgggc	Protospacer
 *.********* ***********.*  

2320. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgtatcggcatcggcatcggcatcgggt	Protospacer
 *.********* ***********.*  

2321. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2322. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgtatcggcatcggcatcggcatcgggc	Protospacer
 *.********* ***********.*  

2323. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2324. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgtatcggcatcggcatcggcatcgggc	Protospacer
 *.********* ***********.*  

2325. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2326. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgtatcggcatcggcatcggcatcgggc	Protospacer
 *.********* ***********.*  

2327. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccgcgtga	Protospacer
************ ********  *.  *

2328. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_MF600313 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agcatcagcatcagcatcggcatcgaga	Protospacer
.*****.***** ***********.. *

2329. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatctgcatcggcatcggcatcgacg	Protospacer
 ***** ***** ***********..*.

2330. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcaccggcatcggcatcggcatcgtgg	Protospacer
****.******* ***********.  .

2331. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatccgcatgcgcatcggcatcgatg	Protospacer
****** **** ************....

2332. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcgtcggcatcctgc	Protospacer
************ **.********    

2333. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gtgatcggcatcggcatcggcatcatgc	Protospacer
*  ********* ************   

2334. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP039925 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tgcatcggcatccgcatcggaatagacg	Protospacer
 ******************* ** ..*.

2335. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
atggtcggcatccgaatcggcttcagca	Protospacer
.  .********** ****** ******

2336. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP035035 (Pantoea ananatis strain NN08200 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tccatcggcatgcgcatcggcatcttcc	Protospacer
  ********* ************  * 

2337. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatcggcatcggcaaaggcg	Protospacer
 *********** *********  .**.

2338. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatcggcatcggcaaaggcg	Protospacer
 *********** *********  .**.

2339. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatcggcatcggcaaaggcg	Protospacer
 *********** *********  .**.

2340. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP054024 (Rhizobium sp. JKLM12A2 plasmid pPR12A203, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggctgtgtca	Protospacer
************ ********  .. **

2341. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcaacggcatccgcatcggcagcgccg	Protospacer
 *** ***************** *. *.

2342. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
cgcatcggcatcggcatcggcaaaggcg	Protospacer
 *********** *********  .**.

2343. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to MN693976 (Marine virus AFVG_250M247, complete genome) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
gtcgggcgcatcagcatcggcatcagca	Protospacer
* *.   ***** ***************

2344. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggcgtggcga	Protospacer
************ ********.* .  *

2345. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP049734 (Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggctgtgtca	Protospacer
************ ********  .. **

2346. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP049734 (Rhizobium leguminosarum strain A1 plasmid pRLa11, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggctgtgtca	Protospacer
************ ********  .. **

2347. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
acccccggcatcagcatcggcaccagca	Protospacer
. * .******* *********.*****

2348. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggctcaggcg	Protospacer
************ ******** . .**.

2349. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP054035 (Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcagcatcggctgtgtca	Protospacer
************ ********  .. **

2350. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to CP054910 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
agacgcggcatccgcttcggcatcagta	Protospacer
.*   ********** **********.*

2351. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP045322 (Roseivivax sp. THAF197b plasmid pTHAF197b_d, complete sequence) position: , mismatch: 6, identity: 0.786

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
atcatcggcatcatcatcggcatcatcg	Protospacer
. **********  *********** *.

2352. spacer 3.17|3323268|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.85

ggcatctgcatcggcgtcagcgtctgcatctgaatcagca	CRISPR spacer
tgaatctgcatctgcgtctgcgtctgcatctgaatctgaa	Protospacer
 * ********* ***** ***************** * *

2353. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatcagcatccgcatcggcatccgcg	Protospacer
 ********************.**** *** * .

2354. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatcagcatccgcatcggcatccgcg	Protospacer
 ********************.**** *** * .

2355. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcgtcggcatcagcatccgcatcggcgtcagca	Protospacer
***.*****************.**** .**.* *

2356. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatctgcg	Protospacer
 *********** ************* *** * .

2357. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcgtcagca	Protospacer
***.******** ************* .**.* *

2358. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatctgcg	Protospacer
 *********** ************* *** * .

2359. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcgtccgca	Protospacer
***.******** ************* .** * *

2360. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcgtcggcatccgcatccgcgtcggcgtcagca	Protospacer
***.******** ************* .**.* *

2361. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to CP003676 (Staphylococcus warneri SG1 plasmid clone pvSw7 genomic sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcagcatcagcgtcggcatcagcg	Protospacer
.***************** ******* ***.* .

2362. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcgtcggcatcagcatccgcgtcggcgtcagca	Protospacer
.**.********************** .**.* *

2363. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcatcagcatctgcatccgcgtcggcgtctgca	Protospacer
******.***** ************* .** * *

2364. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcggcatccgcgtcggcatccgcg	Protospacer
.***********.************* *** * .

2365. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcagcatctgcgtcggcatctgcg	Protospacer
.*****************.******* *** * .

2366. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcagcatctgcgtcggcatctgcg	Protospacer
.*****************.******* *** * .

2367. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcagcatctgcgtcggcatctgcg	Protospacer
.*****************.******* *** * .

2368. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcatcggcatcagcatccgcatcggcgtccgcg	Protospacer
*********************.**** .** * .

2369. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcgtcggcatcagcatccgcgtcggcgtccgca	Protospacer
 **.********************** .** * *

2370. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatctgcg	Protospacer
 *********** ************* *** * .

2371. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.824

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcgtcggcatcagcatccgcatcggcgtcagca	Protospacer
***.*****************.**** .**.* *

2372. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2373. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgca----tcggcatccgca	CRISPR spacer
ggcatctgcatcggcatctgcatcgctcggcatc----	Protospacer
******.***********.***    ********    

2374. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.824

--ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tcggcatc--gctcggcatccgcatcggcgtcggca	Protospacer
  ******    *****************.** ***

2375. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2376. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2377. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2378. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2379. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2380. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2381. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2382. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2383. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2384. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2385. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2386. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2387. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2388. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2389. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2390. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2391. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2392. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2393. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2394. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2395. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2396. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2397. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgca	Protospacer
    ******** *********** *********

2398. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaat	Protospacer
****** *********** *********** .  

2399. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaat	Protospacer
****** *********** *********** .  

2400. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcatcgaat	Protospacer
****** *********** *********** .  

2401. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 6, identity: 0.824

ggcatcc-gcatcggcatccgcatcggcatccgca	CRISPR spacer
-gcatccggcatcggcatcggcgtcggcatcctgc	Protospacer
 ****** *********** **.*********   

2402. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcatctgcatctgcgtctgcatctgaa	Protospacer
 **.******** *********** * .

2403. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcatctgcgtcggcatcggca	Protospacer
 * .******** ***** ********.

2404. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgcgtctgaatctgcgtctgcatctgaa	Protospacer
 ******* *** *********** * .

2405. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggca	Protospacer
 * .** ***** **************.

2406. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcgtcggcgtcggcatcggca	Protospacer
 * .*****.******** ********.

2407. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggca	Protospacer
 * .** ***** **************.

2408. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcgtcggcgtcggcatcggca	Protospacer
 * .*****.******** ********.

2409. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggca	Protospacer
 * .** ***** **************.

2410. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcgtcggcgtcggcatcggca	Protospacer
 * .*****.******** ********.

2411. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcgtcggcgtcggcatcggca	Protospacer
 * .*****.******** ********.

2412. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggca	Protospacer
 * .** ***** **************.

2413. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggca	Protospacer
 * .** ***** **************.

2414. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatctgcgtcggcgtcggcatcggca	Protospacer
 * .*****.******** ********.

2415. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
tgaatcagcatccgcgtctgcatcggca	Protospacer
 * .** ***** **************.

2416. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ggcatctgcatcggcatctgcatcgctc	Protospacer
.**.***********.********* . 

2417. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gaattctgcatctgcgtctgcatcgacg	Protospacer
..  ******** ************.**

2418. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP025614 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctgttctgcatcggcttgtgcatcggcg	Protospacer
    *********** * **********

2419. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2420. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2421. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtcagcatcagcgtctgcatggagc	Protospacer
****** *****.********** *.  

2422. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
acgctctgcatcggcgtcggcatgggcc	Protospacer
*   ************** **** *** 

2423. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
acgctctgcatcggcgtcggcatgggcc	Protospacer
*   ************** **** *** 

2424. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2425. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2426. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
acgctctgcatcggcgtcggcatgggcc	Protospacer
*   ************** **** *** 

2427. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
acgctctgcatcggcgtcggcatgggcc	Protospacer
*   ************** **** *** 

2428. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP016454 (Sphingobium sp. RAC03 plasmid pBSY17_4, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
acgctctgcatcggcgtcggcatgggcc	Protospacer
*   ************** **** *** 

2429. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP016454 (Sphingobium sp. RAC03 plasmid pBSY17_4, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
acgctctgcatcggcgtcggcatgggcc	Protospacer
*   ************** **** *** 

2430. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MN369749 (Mycobacterium phage MinionDave, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2431. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MH632118 (Mycobacterium phage Zeeculate, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2432. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MT684593 (Mycobacterium phage Moonbeam, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2433. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MF919508 (Mycobacterium phage ILeeKay, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2434. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to JN153085 (Mycobacterium phage Doom, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2435. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MF431615 (Lentibacter virus vB_LenP_VB3, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agtgtctacatcggcgtctgcataacca	Protospacer
**.****.*************** . *.

2436. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2437. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to KM652553 (Mycobacterium phage CaptainTrips, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2438. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MH825707 (Mycobacterium phage MilleniumForce, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
aagacctgcaacggcgtctgcatgggcg	Protospacer
*. ..***** ************ ****

2439. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2440. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2441. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2442. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2443. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2444. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2445. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2446. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2447. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2448. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2449. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2450. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2451. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2452. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2453. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2454. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2455. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
gccatctgcatctgcatctgcatcggca	Protospacer
. *.******** **.***********.

2456. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2457. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2458. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2459. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2460. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2461. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctcgcgtgcatcggcgtcggcatcggcc	Protospacer
  **. ************ ******** 

2462. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NC_048672 (Lentibacter virus vB_LenP_ICBM1, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agtgtctacatcggcgtctgcataacca	Protospacer
**.****.*************** . *.

2463. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to MF431617 (Lentibacter virus vB_LenP_VB1, complete genome) position: , mismatch: 6, identity: 0.786

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agtgtctacatcggcgtctgcataacca	Protospacer
**.****.*************** . *.

2464. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcgtcggcatccgcgtcggca	Protospacer
 * .*****.******** ********.

2465. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatcagcatcggcgtcagcgtcggca	Protospacer
 * .** ********.***********.

2466. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcgtcggcatccgcgtcggca	Protospacer
 * .*****.******** ********.

2467. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatcggcgtccgcgtcggca	Protospacer
 * .***********.** ********.

2468. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatcagcatcggcgtcagcgtcggca	Protospacer
 * .** ********.***********.

2469. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatctgcatcggcatctgcgtcggca	Protospacer
.* .**.*********** ********.

2470. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatctgcatcggcatctgcgtcggca	Protospacer
.* .**.*********** ********.

2471. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatctgcatcggcatctgcgtcggca	Protospacer
.* .**.*********** ********.

2472. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatctgcatcggcatctgcgtcggca	Protospacer
.* .**.*********** ********.

2473. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatctgcatcggcatctgcgtcggca	Protospacer
.* .**.*********** ********.

2474. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatctgcatcggcatctgcgtcggca	Protospacer
.* .**.*********** ********.

2475. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatccgcatccgcgtcggca	Protospacer
 * .******** ***** ********.

2476. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcatctgcgtccgca	Protospacer
.* .************** ***** **.

2477. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatcagcatccgcatcagcgtcggca	Protospacer
.* .** ***** **************.

2478. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatccgcatccgcgtcggca	Protospacer
 * .******** ***** ********.

2479. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtccgcgtcggca	Protospacer
.* .***********.** ********.

2480. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatcggcgtcggcatcagcgtcggca	Protospacer
.* .** **.*****************.

2481. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatccgcatcagcgtcagcgtcggca	Protospacer
 * .********.**.***********.

2482. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatccgcatccgcgtcggca	Protospacer
.* .******** ***** ********.

2483. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtccgcgtcggca	Protospacer
.* .***********.** ********.

2484. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatccgcatcggcgtccgcgtcggca	Protospacer
.* .***********.** ********.

2485. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatccgcgtcagcgtcggca	Protospacer
 * .******** **.***********.

2486. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatccgcatcggcgtcagcgtcagca	Protospacer
 * .***********.********.**.

2487. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cacatcagcatcggcatcagcgtcggca	Protospacer
 . .** ********************.

2488. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcatcagcatcggcatccgcgtcggca	Protospacer
 * .** *********** ********.

2489. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tgcatcagcatcggcatccgcgtcggca	Protospacer
 * .** *********** ********.

2490. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ctgatccgcatcggcatccgcgtcggca	Protospacer
  ..************** ********.

2491. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
agcatcggcatcggcatcagcatcggca	Protospacer
.* .** **************.*****.

2492. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tacttccgcatcgggatcaacgtcggcg	Protospacer
 .  ********** ****.********

2493. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tcgatcggcagcggcatcagcgtcggcg	Protospacer
  ..** *** *****************

2494. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ccgatcggcatcggcatcagcatcggcg	Protospacer
  ..** **************.******

2495. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
tacttccgcatcgggatcaacgtcggcg	Protospacer
 .  ********** ****.********

2496. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2497. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2498. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcctgggcatcggcatcggcgtcggcg	Protospacer
 *  *  ***********.*********

2499. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2500. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2501. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ccggcccgcaacggcagcagcgtcggcg	Protospacer
  .*.***** ***** ***********

2502. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aatggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2503. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gccgtccgcatcggcatcagcaacggaa	Protospacer
*  ******************. *** .

2504. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2505. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2506. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2507. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gacacccgcatcggcatccgcgtccgcg	Protospacer
*. ..************* ***** ***

2508. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gcgcgccgcttcggcatcagcgtcgccg	Protospacer
* .  **** *************** **

2509. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2510. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gtcgatagcctcggcatcagcgtcggcg	Protospacer
*  * . ** ******************

2511. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ggtgtccgcatcggcatcagcagccgga	Protospacer
** ******************. * * .

2512. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2513. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2514. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2515. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gccgtcagcatcggcaccagcgtcggta	Protospacer
*  *** *********.*********..

2516. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2517. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2518. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cgcctgggcatcggcatcggcgtcggcg	Protospacer
 *  *  ***********.*********

2519. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2520. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gacacccgcatcggcatccgcgtccgcg	Protospacer
*. ..************* ***** ***

2521. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2522. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2523. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2524. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2525. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2526. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2527. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2528. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2529. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2530. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2531. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2532. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2533. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2534. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2535. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2536. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2537. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2538. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2539. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2540. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2541. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2542. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2543. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2544. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2545. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2546. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2547. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2548. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2549. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2550. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2551. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2552. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2553. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2554. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2555. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2556. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2557. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2558. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2559. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2560. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2561. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2562. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2563. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2564. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2565. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2566. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2567. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2568. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
aacggccgcatcggcatcagcggcagcg	Protospacer
.. * ***************** *.***

2569. spacer 3.34|3324306|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786

ggcgtccgcatccgcatcagaatcggag	CRISPR spacer
tgcgtccgcatcggcatcagcatccgca	Protospacer
 *********** ******* *** * .

2570. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcatcggcg	Protospacer
.* ********* ********.**** .

2571. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcggcatccgcgtcagcgtcagcg	Protospacer
 * *** *****************.* .

2572. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggcg	Protospacer
 * ************.** ******* .

2573. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcg	Protospacer
.* ************.** ******* .

2574. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcg	Protospacer
.* ************.** ******* .

2575. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatcggcgtcagcatcggcg	Protospacer
.* ********* ********.**** .

2576. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcagcatccgcgtcagcgtcagcg	Protospacer
.* *** *****************.* .

2577. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcggcatcggcg	Protospacer
.* ***************.**.**** .

2578. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatccgcatccgcgtcggcatcggcg	Protospacer
.* ***************.**.**** .

2579. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatcggcatccgcgtccgcgtcggcg	Protospacer
 * *** *********** ******* .

2580. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatcggcgtccgcgtcggcg	Protospacer
 * ********* ***** ******* .

2581. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatccgcatcagcgtcagcg	Protospacer
 * ************.********.* .

2582. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
cgcatccgcatcagcgtcagcgtcagcg	Protospacer
 * ********* ***********.* .

2583. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_AP022320 (Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggggtccgcatccgagtcagcgtcggtg	Protospacer
.*..********** *********** .

2584. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gacttccgcatccgcgtcaccgtcgcaa	Protospacer
..  *************** ***** **

2585. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcggcatcggcgtcagcgtcggcg	Protospacer
.* *** ***** ************* .

2586. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ggcatcggcatctgcgtcagcgtcggcg	Protospacer
.* *** *****.************* .

2587. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to MK919474 (Microbacterium phage Lupine, complete genome) position: , mismatch: 6, identity: 0.786

cgcgtcggaatcggaatcggaatcggca	CRISPR spacer
aatgacggaatcggaagcggaatcggcg	Protospacer
 ..* *********** **********.

2588. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NZ_CP014308 (Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cgcgtcggaatcggaatcggaatcggca	CRISPR spacer
ggggttggaatcggaatcgggatcgggt	Protospacer
 * **.**************.*****  

2589. spacer 3.37|3324444|28|NZ_CP042930|CRT matches to NZ_CP014309 (Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

cgcgtcggaatcggaatcggaatcggca	CRISPR spacer
ggggttggaatcggaatcgggatcgggt	Protospacer
 * **.**************.*****  

2590. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.85

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
agcatctgcatcggcatcggcatccgcatcggcatccgcg	Protospacer
 *********** ***********.*********** * .

2591. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.85

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
ggcatctgcgtcggcatcggcatctgcatcggcatctgcg	Protospacer
 ********.** *********************** * .

2592. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.85

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatctgcatccgcatccgcatccgcatcagcgtcagcg	Protospacer
************ **.**************** .**.* *

2593. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggcg	Protospacer
 ***********.***** ***** * .

2594. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcg	Protospacer
.***********.***** ***** * .

2595. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatcggcgtcagcg	Protospacer
.***********.*****.***** * .

2596. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcg	Protospacer
.***********.***** ***** * .

2597. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatcggcatctgcatcggcgtcagcg	Protospacer
 ***** ***********.***** * .

2598. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatctgcatctgcatccgcgtcggcg	Protospacer
.*****.*********** ***** * .

2599. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2600. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcg	Protospacer
.*********** ***** ***** * .

2601. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2602. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatccgcgtcggcg	Protospacer
 ***** *********** ***** * .

2603. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2604. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2605. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
.*********** **.******** * .

2606. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2607. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatcggcgtcagcg	Protospacer
.*********** *****.***** * .

2608. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcgtccgcatctgcatcagcatccgcg	Protospacer
 **.*****************.**.* .

2609. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatctgcatctgcatcagcatcagcg	Protospacer
 *****.**************.** * .

2610. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatctgcatcagcatcagcgtcggcg	Protospacer
 *****.***** *********** * .

2611. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatcggcatctgcgtcagcgtcggcg	Protospacer
.***** ********.******** * .

2612. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatcggcgtccgcg	Protospacer
.***********.*****.*****.* .

2613. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2614. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatcagcgtcagcgtcagcg	Protospacer
 *********** **.******** * .

2615. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatccgcatcggcgtcagcg	Protospacer
.***********.*****.***** * .

2616. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtcagcg	Protospacer
.*********** ***** ***** * .

2617. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatctgcatctgcatccgcgtcggcg	Protospacer
.*****.*********** ***** * .

2618. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2619. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcg	Protospacer
.*********** ***** ***** * .

2620. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2621. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcagcatctgcatccgcgtcggcg	Protospacer
 ***** *********** ***** * .

2622. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2623. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2624. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcatcggcgtccgcg	Protospacer
 ***********.*****.*****.* .

2625. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
.*********** **.******** * .

2626. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatctgcgtccgcg	Protospacer
.*********** ***** *****.* .

2627. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatcggcgtcagcg	Protospacer
.*********** *****.***** * .

2628. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcagcatcggcgtccgcg	Protospacer
.*********** *****.*****.* .

2629. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatccgcatcggcgtcagcgtcggcg	Protospacer
.*********** **.******** * .

2630. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatccgcatccgcatccgcgtcagcg	Protospacer
 ***********.***** ***** * .

2631. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
cgcatccgcatccgcgtcagcgtcagcg	Protospacer
 ***********.**.******** * .

2632. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatccgcatccgcatccgcgtcagcg	Protospacer
 ***********.***** ***** * .

2633. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ggcatctgcatctgcatccgcgtcggcg	Protospacer
.*****.*********** ***** * .

2634. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP017294 (Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tccatccgcatctgcatcagaatctcca	Protospacer
  ****************** .***  *

2635. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
gccatctgcatccgcatcagcgtctcca	Protospacer
. ****.*****.************  *

2636. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to CP003674 (Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence) position: , mismatch: 6, identity: 0.786

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatcggcatcagcatcagcgtcagcg	Protospacer
 ***** ***** *********** * .

2637. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 6, identity: 0.812

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcaatggttcaggtgctggcgctggagttatc	Protospacer
*.******** ************** **   *

2638. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MG969407 (UNVERIFIED: Salmonella phage GE_vB_BS, complete genome) position: , mismatch: 6, identity: 0.812

ttattttatccctgtaataatgcta-atggatg	CRISPR spacer
tcattttatccctctaataatgatatattcat-	Protospacer
*.*********** ******** ** **  ** 

2639. spacer 6.12|3729642|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.812

aaattttttccctgccgcaatatccgggatcg-	CRISPR spacer
aaatattttccctgccgcaatgt-cgcggtcac	Protospacer
**** ****************.* ** *.**. 

2640. spacer 6.31|3730797|32|NZ_CP042930|PILER-CR matches to NZ_LT883141 (Escherichia coli isolate 6666666.257727.embl plasmid III) position: , mismatch: 6, identity: 0.812

-tctggttatattcaataaagcctgacggtacg	CRISPR spacer
atcttatt-tattcaacaaagcctgacggaact	Protospacer
 *** .** *******.************ ** 

2641. spacer 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_LT883141 (Escherichia coli isolate 6666666.257727.embl plasmid III) position: , mismatch: 6, identity: 0.812

-tctggttatattcaataaagcctgacggtacg	CRISPR spacer
atcttatt-tattcaacaaagcctgacggaact	Protospacer
 *** .** *******.************ ** 

2642. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatcggcgtcggcatccgca	Protospacer
 * ***************.***** ***** * .

2643. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcatcggcatccgcatccgcgtcggcatctgca	Protospacer
 * *************** ***** ***** * .

2644. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcgtcggcatccgcatctgcgtcagcatctgcg	Protospacer
.* .************** ***** ***** * *

2645. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatcggcatcagcgtcggcatccgca	Protospacer
** .******** *********** ***** * .

2646. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcggcatctgcgtctgcatcggca	Protospacer
.* ********* ***** ***********.* .

2647. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2648. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtcggcgtctgcatctgcg	Protospacer
 * .***********.**.*********** * *

2649. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2650. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2651. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtcggcgtctgcatctgcg	Protospacer
 * .***********.**.*********** * *

2652. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2653. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtcggcgtctgcatctgcg	Protospacer
 * .***********.**.*********** * *

2654. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtcggcgtctgcatctgcg	Protospacer
 * .***********.**.*********** * *

2655. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2656. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtcggcgtctgcatctgcg	Protospacer
 * .***********.**.*********** * *

2657. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2658. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2659. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtcggcgtctgcatctgcg	Protospacer
 * .***********.**.*********** * *

2660. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcgtcggcatccgcgtctgcgtctgcatctgcg	Protospacer
 * .***********.** *********** * *

2661. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcagcgtcagcatcggca	Protospacer
 * .******************** *****.* .

2662. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcatcggcatccgcatccgcgtcggcatccgca	Protospacer
 * *************** ***** ***** * .

2663. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
agcgtcggcatccgcatcggcgtcagcatcggca	Protospacer
** .**************.***** *****.* .

2664. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcggcatcagcgtcggcatcggca	Protospacer
.* ********* *********** *****.* .

2665. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcatcggcatcggcatcagcgtcggcatcggca	Protospacer
.* ********* *********** *****.* .

2666. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcggcgtcggcatcggcg	Protospacer
 * .**************.***** *****.* *

2667. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcgtcggcatccgcatcggcgtcagcatcggcg	Protospacer
.* .**************.***** *****.* *

2668. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcgtcggcatccgcatcggcgtcagcatctgcg	Protospacer
.* .**************.***** ***** * *

2669. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcggcgtcggcatcggcg	Protospacer
 * .**************.***** *****.* *

2670. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 7, identity: 0.794

--agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ttcggat--gcatctgcatcagcgtccgcatcagat	Protospacer
   *.**  *****.***********.******** 

2671. spacer 3.9|3322830|28|NZ_CP042930|CRT matches to NZ_CP025015 (Rhizobium leguminosarum strain Norway plasmid pRLN3, complete sequence) position: , mismatch: 7, identity: 0.75

agcgtcggcatccgaatccgcatccgaa	CRISPR spacer
gaagtcggcagccgaatccgcatacggc	Protospacer
.. ******* ************ **. 

2672. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggcgatgatg	Protospacer
****************** *****.**. .*..*

2673. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcgagattgtgg	Protospacer
****************** *****.. **.*  *

2674. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2675. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcgggtgggccg	Protospacer
****************** *****.*    * **

2676. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
agcatcggcatcggcatcggcatcggcaggcgcc	Protospacer
.***************** *****.***   ** 

2677. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2678. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2679. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2680. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2681. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2682. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****************** *****.**  **  .

2683. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggtttcggcatcggcatcggcatcggcatcgcgc	Protospacer
**. ************** *****.******   

2684. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg-	CRISPR spacer
tgcggcggcatcggcatctgcgtctgcat-gtcga	Protospacer
 **. ****************.** **** * ** 

2685. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg-	CRISPR spacer
tgcggcggcatcggcatctgcgtctgcat-gtcga	Protospacer
 **. ****************.** **** * ** 

2686. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcgtcggcatcctgcccggcg	Protospacer
***************.** *****    .*****

2687. spacer 3.14|3323100|34|NZ_CP042930|CRT matches to NZ_MF600313 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcagcatcagcatcagagtcggagtccgca	CRISPR spacer
agcatcagcatcagcatcagcatcggcatcgaga	Protospacer
******************** .**** .** . *

2688. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcaaagatg	Protospacer
************ *********  ....

2689. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcaaagatg	Protospacer
************ *********  ....

2690. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcaaagatg	Protospacer
************ *********  ....

2691. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcggagccg	Protospacer
************ ********.  . *.

2692. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggccggggag	Protospacer
************ ********   .* .

2693. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
catgccggcatcggcatcggcatcggca	Protospacer
 ....******* ***********.***

2694. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcgggatcggcattttgg	Protospacer
************ * ********.   .

2695. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ttcatcggcatcggcatcggcatctctg	Protospacer
  ********** ***********  ..

2696. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
atggtcggcatccgcatggacatcagcc	Protospacer
.  .************* *.******* 

2697. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_LR134428 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 19) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
atgtgcgccatccgaatcggcatcagca	Protospacer
.    ** ****** *************

2698. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
aaggtcggcatccgcggcggcatcagcg	Protospacer
.. .***********. **********.

2699. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcgacatcggcatcggcatagctg	Protospacer
*******.**** ********** . ..

2700. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcaaccgcatcggctcgtact	Protospacer
********** ********** .  .* 

2701. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
aaggtcggcatccgcggcggcatcagcg	Protospacer
.. .***********. **********.

2702. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tacatcggcaaccgcatcggcaacatgc	Protospacer
 .******** *********** **   

2703. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP049117 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
tccatcggcatgcgcatcggcattgtcc	Protospacer
  ********* ***********.. * 

2704. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2705. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2706. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2707. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2708. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2709. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2710. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2711. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcatctgcatctgaatcagcatctgcgtctgaa	Protospacer
 * ******.******************** ***** * .

2712. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgagtcagcgtctgcatctgagtcagcatctgcgtctgaa	Protospacer
 * ******************.******** ***** * .

2713. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgaatcagcatctgcatctgaatcagcatctgcgtctgag	Protospacer
 * .*****.******************** ***** * *

2714. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgaatcagcatctgcatctgaatcagcatctgcgtctgag	Protospacer
 * .*****.******************** ***** * *

2715. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgaatcagcatctgcatctgaatcagcatctgcgtctgag	Protospacer
 * .*****.******************** ***** * *

2716. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.825

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgaatcagcatctgcatctgaatcagcatctgcgtctgag	Protospacer
 * .*****.******************** ***** * *

2717. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatccgcatccgcatccgcgtcggcgtccgca	Protospacer
 ***** ***** ************* .** * *

2718. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcgtccgcgtcggcgtccgca	Protospacer
 *********** **.********** .** * *

2719. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcagcatcggcatccgcgtcggcgtccgca	Protospacer
 *****.*****.************* .** * *

2720. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatccgcatccgcatccgcgtcggcgtccgca	Protospacer
.***** ***** ************* .** * *

2721. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcgtccgcgtcggcgtccgca	Protospacer
 *********** **.********** .** * *

2722. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcgtcagcatctgcgtcggcgtcagca	Protospacer
 ********.********.******* .**.* *

2723. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatcagcatccgcatcggcgtcagcg	Protospacer
 ********************.**** .**.* .

2724. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcagcatccgcatcggcgtcagcg	Protospacer
.********************.**** .**.* .

2725. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcgtccgca	Protospacer
.***** *****.************* .** * *

2726. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcagcatctgcatccgcgtcggcgtccgca	Protospacer
 *****.***** ************* .** * *

2727. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcgtccgcgtcggcgtccgca	Protospacer
 *********** **.********** .** * *

2728. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcatccgcatccgcatccgcgtcagcgtcagca	Protospacer
****** ***** ***********.* .**.* *

2729. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatcagcatccgcatcggcgtcagcg	Protospacer
 ********************.**** .**.* .

2730. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatcagcatccgcatcggcgtcagcg	Protospacer
.********************.**** .**.* .

2731. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatccgcatcggcatccgcgtcggcgtccgca	Protospacer
.***** *****.************* .** * *

2732. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcagcatctgcatccgcgtcggcgtccgca	Protospacer
 *****.***** ************* .** * *

2733. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatctgcgtccgcgtcggcgtccgca	Protospacer
 *********** **.********** .** * *

2734. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcgtccgcgtcggcgtccgca	Protospacer
 *********** **.********** .** * *

2735. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcatccgcatccgcatccgcgtcagcgtcagca	Protospacer
****** ***** ***********.* .**.* *

2736. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatctgcatcagcatcagcgtcggcgtctgca	Protospacer
 ***** *********** ******* .** * *

2737. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcggcatcagcatctgcatcggcgtccgca	Protospacer
 *****************.**.**** .** * *

2738. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcagcatcagcatctgcgtcggcgtctgca	Protospacer
 *****.***********.******* .** * *

2739. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcagcatcagcatctgcgtcggcgtctgca	Protospacer
 *****.***********.******* .** * *

2740. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcgtcggcatcagcatcagcgtcggcgtctgca	Protospacer
.**.************** ******* .** * *

2741. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcgtcggcatcagcatcagcgtcggcgtctgca	Protospacer
.**.************** ******* .** * *

2742. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcgtcggcatcagcatcagcgtcggcgtctgca	Protospacer
.**.************** ******* .** * *

2743. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcgtcggcatcagcatcagcgtcggcgtctgca	Protospacer
.**.************** ******* .** * *

2744. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcagcatcagcatctgcgtcggcgtctgca	Protospacer
 *****.***********.******* .** * *

2745. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcgtcagca	Protospacer
 **.*****************.**** .**.* *

2746. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcatccgcatccgcatccgcgtcagcgtcagca	Protospacer
****** ***** ***********.* .**.* *

2747. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
agcgtcggcatcagcatccgcatcggcgtcagcg	Protospacer
***.*****************.**** .**.* .

2748. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
aacagcaacatccgcatccgcatccgcatccgca	Protospacer
..** * .**** *********** *********

2749. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2750. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2751. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgccttttcatcggcatcggcatcggcatcggca	Protospacer
 ** *.. ********** *********** ***

2752. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgccttttcatcggcatcggcatcggcatcggca	Protospacer
 ** *.. ********** *********** ***

2753. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgccttttcatcggcatcggcatcggcatcggca	Protospacer
 ** *.. ********** *********** ***

2754. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggca	Protospacer
. *  *.*********** *********** ***

2755. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggca	Protospacer
. *  *.*********** *********** ***

2756. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggca	Protospacer
. *  *.*********** *********** ***

2757. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcgcccgccacc	Protospacer
****** *********** ****** *  **.* 

2758. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgcc	Protospacer
    ******** *********** ******** 

2759. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2760. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2761. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2762. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2763. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2764. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2765. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgcc	Protospacer
    ******** *********** ******** 

2766. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2767. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2768. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2769. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2770. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgcc	Protospacer
    ******** *********** ******** 

2771. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccgcgtga	Protospacer
****** *********** ********  *   *

2772. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcgatcgtttcggcatcggcatcggcatcggca	Protospacer
***. .**. ******** *********** ***

2773. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattccgcatccgcatccgcatccgcatccgcc	Protospacer
    ******** *********** ******** 

2774. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggtgtcggtttcggcatcggcatcggcatcggca	Protospacer
**..** *. ******** *********** ***

2775. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_KX868552 (Klebsiella variicola strain H152460787 plasmid pJF-787, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gccatccgcttcggcatccgcagcgggcgcggca	Protospacer
* ******* ************ ***   * ***

2776. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_LC511995 (Enterobacter hormaechei subsp. xiangfangensis strain MY146 plasmid pMY146-rmtE, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gccatccgcttcggcatccgcagcgggcgcggca	Protospacer
* ******* ************ ***   * ***

2777. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_LC511996 (Enterobacter hormaechei subsp. xiangfangensis strain MY458 plasmid pMY458-rmtE, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gccatccgcttcggcatccgcagcgggcgcggca	Protospacer
* ******* ************ ***   * ***

2778. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_LC511997 (Enterobacter hormaechei subsp. xiangfangensis strain MY460 plasmid pMY460-rmtE, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gccatccgcttcggcatccgcagcgggcgcggca	Protospacer
* ******* ************ ***   * ***

2779. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_MH325469 (Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence) position: , mismatch: 7, identity: 0.794

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gccatccgcttcggcatccgcagcgggcgcggca	Protospacer
* ******* ************ ***   * ***

2780. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP038792 (Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence) position: , mismatch: 7, identity: 0.75

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctggtctgcatcggcgtcagtatcggta	Protospacer
   *************** *.*****..

2781. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.75

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctgatctgcatcggcgtcggcatcgtca	Protospacer
   .************** ****** *.

2782. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP023471 (Salmonella enterica subsp. enterica strain BAA-1672 plasmid pSalSendai, complete sequence) position: , mismatch: 7, identity: 0.75

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctggtctgcatcggcgtcagtatcggta	Protospacer
   *************** *.*****..

2783. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 7, identity: 0.75

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
ctggtctgcatcggcgtcagtatcggta	Protospacer
   *************** *.*****..

2784. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatcagcatctgcgtccgcatctgattcatcg	Protospacer
************.***** ***** *  **  **

2785. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
tgagtcagcatctgcgtctgcatcagcatctgaa	Protospacer
 * .********.***** ************* .

2786. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
accatcatcatccgcttcggcatcagccgctcca	Protospacer
* ***** ******* ***********  ** *.

2787. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
cgcaccctgatcggcgtcggcaccagcatctgcg	Protospacer
 ***.*   *** *********.***********

2788. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 7, identity: 0.794

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
cgcatcggcatccgcatccgcgccggcaatgccg	Protospacer
************ *********.*** * .* *.

2789. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cggcgtcgcatcggcatctgcgtcggca	Protospacer
 *.  .************ ********.

2790. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_014957 (Isosphaera pallida ATCC 43644 plasmid pISOP01, complete sequence) position: , mismatch: 7, identity: 0.75

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
cacaccggcatcggcatcggcgtcggcg	Protospacer
 . ..* ***********.*********

2791. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.75

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ttcccccgcatcggcatcagcggcgccg	Protospacer
    .***************** ** **

2792. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.75

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
gcgatcagcatcggcatcagcgtcgatt	Protospacer
* ..** ******************.. 

2793. spacer 3.31|3324168|28|NZ_CP042930|CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.75

ggagtccgcatcggcatcagcgtcggcg	CRISPR spacer
ccgatccgccccggcatcagcgtcggca	Protospacer
  ..***** .****************.

2794. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gatttccgcatccgcgtcaccgtcgcca	Protospacer
..  *************** *****  *

2795. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gatttccgcatccgcgtcaccgtcgcca	Protospacer
..  *************** *****  *

2796. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gatttccgcatccgcgtcaccgtcgcca	Protospacer
..  *************** *****  *

2797. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gatttccgcatccgcgtcaccgtcgcca	Protospacer
..  *************** *****  *

2798. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gaaaaccgcatccgcgtcagcgccgcct	Protospacer
..** *****************.**   

2799. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to KC117377 (Halovirus HVTV-1, complete genome) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
aacctccgcatcctcgtcagcgtcgctg	Protospacer
*.  ********* ***********  .

2800. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gatttccgcatccgcgtcaccgtcgcca	Protospacer
..  *************** *****  *

2801. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
ccgatccgcatccacgtgagcgtcggcg	Protospacer
  .**********.*** ******** .

2802. spacer 3.35|3324354|28|NZ_CP042930|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.75

agaatccgcatccgcgtcagcgtcggaa	CRISPR spacer
gatttccgcatccgcgtcaccgtcgcca	Protospacer
..  *************** *****  *

2803. spacer 3.42|3324708|40|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 7, identity: 0.825

cgcgtcggaatcggcatccgcatcggcgtcagaatcggag	CRISPR spacer
cgcgtcggcatccgcatccgcatcggcgtcagcgtcagca	Protospacer
******** *** ******************* .**.* .

2804. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 7, identity: 0.825

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatcggcatcggcatccgcatccgcatcggcgtcagcg	Protospacer
****** ********.**************.* .**.* *

2805. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 7, identity: 0.825

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatcggcatcggcgtcagcatccgcatcggcgtccgcg	Protospacer
****** *********** ***********.* .** * *

2806. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041098 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.825

cgcgtcagagtcagagtcagagtcagagtcagaatcggag	CRISPR spacer
ggattttgagtcagagtcagagtcagagtcagagtcagag	Protospacer
 *  *. **************************.**.***

2807. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
gagatccgcatcggcatccgcgtctgcg	Protospacer
.. ********* ***** ******* .

2808. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttgctcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2809. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttgctcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2810. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttgctcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2811. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttgctcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2812. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttactcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2813. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttgctcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2814. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
ttgctcagcatctgcatcagcgtcagac	Protospacer
    ** ***************** ** 

2815. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
gcggtggttgcggtgctggcgctggcg-gtgca	Protospacer
*...***** ***************** .*.* 

2816. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP009119 (Borreliella valaisiana Tom4006 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
ctcttttattcctttaataatgctaactggtg	Protospacer
.* ******.*** ************. *.**

2817. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 7, identity: 0.781

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
gcctagcaatccattgctgattggattaccaa	Protospacer
*.. *. *******.************ ****

2818. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 7, identity: 0.781

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
gcctagcaatccattgctgattggattaccaa	Protospacer
*.. *. *******.************ ****

2819. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to LN828717 (Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome) position: , mismatch: 7, identity: 0.781

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
gcctagcaatccattgctgattggattaccaa	Protospacer
*.. *. *******.************ ****

2820. spacer 6.25|3730430|33|NZ_CP042930|PILER-CR matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 7, identity: 0.788

tgcgacacgttctatgtcggcacgactaaagac	CRISPR spacer
ggcggcacgatctatgtcggcacgatgagtgac	Protospacer
 ***.**** ***************. *. ***

2821. spacer 6.30|3730736|32|NZ_CP042930|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781

gatcgccctggttatttgcgttga--atacggcc	CRISPR spacer
gatcgccctggtgatttccgttgatggtgcag--	Protospacer
************ **** ******  .*.*.*  

2822. spacer 6.34|3730980|32|NZ_CP042930|PILER-CR matches to HQ634191 (Cyanophage Syn10 genomic sequence) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagtg-	Protospacer
****** *** ************  ** **.  

2823. spacer 6.34|3730980|32|NZ_CP042930|PILER-CR matches to KJ019027 (Synechococcus phage ACG-2014c isolate Syn7803C43, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagaa-	Protospacer
****** *** ************  ** **   

2824. spacer 6.34|3730980|32|NZ_CP042930|PILER-CR matches to DQ149023 (Synechococcus cyanophage syn9, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagtg-	Protospacer
****** *** ************  ** **.  

2825. spacer 6.34|3730980|32|NZ_CP042930|PILER-CR matches to NC_019444 (Synechococcus phage S-MbCM6, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagaa-	Protospacer
****** *** ************  ** **   

2826. spacer 6.34|3730980|32|NZ_CP042930|PILER-CR matches to KJ019128 (Synechococcus phage ACG-2014c isolate Syn7803US88, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagaa-	Protospacer
****** *** ************  ** **   

2827. spacer 6.34|3730980|32|NZ_CP042930|PILER-CR matches to NC_008296 (Synechococcus phage syn9, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagtg-	Protospacer
****** *** ************  ** **.  

2828. spacer 6.39|3731286|32|NZ_CP042930|PILER-CR matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 7, identity: 0.781

gccgat-attttcaaaaatatactcatcgatag	CRISPR spacer
-tgaatgattttcaaaaacatacacatcgataa	Protospacer
 . .** ***********.**** ********.

2829. spacer 6.41|3731408|32|NZ_CP042930|PILER-CR matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ggcggtgccggtgctgagacactgccccaggg	CRISPR spacer
gcgggtgccggtgttgagccactgccccgctg	Protospacer
*  **********.**** *********.  *

2830. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 7, identity: 0.781

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
gcctagcaatccattgctgattggattaccaa	Protospacer
*.. *. *******.************ ****

2831. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 7, identity: 0.781

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
gcctagcaatccattgctgattggattaccaa	Protospacer
*.. *. *******.************ ****

2832. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to LN828717 (Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome) position: , mismatch: 7, identity: 0.781

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
gcctagcaatccattgctgattggattaccaa	Protospacer
*.. *. *******.************ ****

2833. spacer 6.49|3730417|33|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 7, identity: 0.788

tgcgacacgttctatgtcggcacgactaaagac	CRISPR spacer
ggcggcacgatctatgtcggcacgatgagtgac	Protospacer
 ***.**** ***************. *. ***

2834. spacer 6.54|3730723|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781

gatcgccctggttatttgcgttga--atacggcc	CRISPR spacer
gatcgccctggtgatttccgttgatggtgcag--	Protospacer
************ **** ******  .*.*.*  

2835. spacer 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder matches to HQ634191 (Cyanophage Syn10 genomic sequence) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagtg-	Protospacer
****** *** ************  ** **.  

2836. spacer 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder matches to KJ019027 (Synechococcus phage ACG-2014c isolate Syn7803C43, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagaa-	Protospacer
****** *** ************  ** **   

2837. spacer 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder matches to DQ149023 (Synechococcus cyanophage syn9, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagtg-	Protospacer
****** *** ************  ** **.  

2838. spacer 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_019444 (Synechococcus phage S-MbCM6, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagaa-	Protospacer
****** *** ************  ** **   

2839. spacer 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder matches to KJ019128 (Synechococcus phage ACG-2014c isolate Syn7803US88, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagaa-	Protospacer
****** *** ************  ** **   

2840. spacer 6.58|3730967|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_008296 (Synechococcus phage syn9, complete genome) position: , mismatch: 7, identity: 0.781

gctgacatccgttgtgccagttg-ttgcagccc	CRISPR spacer
gctgacctcccttgtgccagttgaatgaagtg-	Protospacer
****** *** ************  ** **.  

2841. spacer 6.63|3731273|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 7, identity: 0.781

gccgat-attttcaaaaatatactcatcgatag	CRISPR spacer
-tgaatgattttcaaaaacatacacatcgataa	Protospacer
 . .** ***********.**** ********.

2842. spacer 6.65|3731395|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ggcggtgccggtgctgagacactgccccaggg	CRISPR spacer
gcgggtgccggtgttgagccactgccccgctg	Protospacer
*  **********.**** *********.  *

2843. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcggcgtccgcatcggca	Protospacer
 * .**************.*****.*****.* .

2844. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatcagcatcagcatctgcatcggca	Protospacer
 * .******** ********.********.* .

2845. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatccgcgtcagcatctgca	Protospacer
 * .************** ***** ***** * .

2846. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ggcgtcggcatccgcatctgcgtccgcatctgca	Protospacer
.* .************** *****.***** * .

2847. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcggcgtccgcatcggca	Protospacer
 * .**************.*****.*****.* .

2848. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatctgcgtccgcatcggca	Protospacer
 * .************** *****.*****.* .

2849. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcggcgtccgcatcggca	Protospacer
 * .**************.*****.*****.* .

2850. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatcggcgtccgcatcggca	Protospacer
 * .**************.*****.*****.* .

2851. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cgcgtcggcatccgcatctgcgtccgcatcggca	Protospacer
 * .************** *****.*****.* .

2852. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to MN694320 (Marine virus AFVG_250M198, complete genome) position: , mismatch: 8, identity: 0.765

agaatcg-----gcatccgcatcagcgtctgcatcagag	CRISPR spacer
-----cgccaatgcatccgcatccgcctctgcatcagac	Protospacer
     **     *********** ** *********** 

2853. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NC_047962 (Xanthomonas phage Carpasina, complete genome) position: , mismatch: 8, identity: 0.765

agaatcggcatccgcatcagcgtctgca---tcagag	CRISPR spacer
agaagcggcatccgcatcagcgtccatgatctca---	Protospacer
**** *******************....   ***   

2854. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to MF754113 (Vibrio phage vB_VpaS_KF3, complete genome) position: , mismatch: 8, identity: 0.765

---agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ctcagaa---gcacccgcatcaccgtctgcatcatct	Protospacer
   ****   ***.******** ***********   

2855. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to MF754114 (Vibrio phage vB_VpaS_KF4, complete genome) position: , mismatch: 8, identity: 0.765

---agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
ctcagaa---gcacccgcatcaccgtctgcatcatct	Protospacer
   ****   ***.******** ***********   

2856. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tttcgctgcatcggcatctgaatcagcatctgcg	Protospacer
  .  * ************* ********* ***

2857. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tttcgctgcatcggcatctgaatcagcatctgcg	Protospacer
  .  * ************* ********* ***

2858. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgccttttcatcggcatcggcatcggcatcggca	Protospacer
 ** *.  ********** *****.********.

2859. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgccttttcatcggcatcggcatcggcatcggca	Protospacer
 ** *.  ********** *****.********.

2860. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgccttttcatcggcatcggcatcggcatcggca	Protospacer
 ** *.  ********** *****.********.

2861. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_008760 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP04, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcatcggcatcggcatcgcccgccacc	Protospacer
****************** *****. *  * .* 

2862. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcg-gcg-----	CRISPR spacer
------ggcatcggcatcggcatcggcatcgcgcgacatg	Protospacer
      ************ *****.****** ***     

2863. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP017423 (Arthrobacter sp. ZXY-2 plasmid pZXY22, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcatcggcttcggcatctacatcgccgttgacc	Protospacer
********* *********.****. *.*.*.* 

2864. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ttaaccgatatcggcatcggcatcagcatcgacg	Protospacer
   *.**..********* ************.**

2865. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to MN657133 (Cryobacterium sp. strain ANT_H10B plasmid pA10BH1, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ttcctggtcatcggcatcggcatcagcctcggtg	Protospacer
  * * * ********** ******** ****.*

2866. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 8, identity: 0.765

--ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
cgggtgccg--ctcggcgtctgcatcggcatcggcg	Protospacer
  **...**   *****.********.*********

2867. spacer 3.14|3323100|34|NZ_CP042930|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcagcatcagcatcagagtcggagtccgca	CRISPR spacer
cacatcagcatcggcatcagcgtcggcatcgaca	Protospacer
 .**********.******* ***** .** .**

2868. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.714

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ggcatcggcatcggcatcggcgatgatg	Protospacer
************ ********. .....

2869. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.714

ggcatcggcatccgcatcggcatcagca	CRISPR spacer
ctgatcggcatcggcatcggcatcctgc	Protospacer
   ********* ***********    

2870. spacer 3.24|3323784|40|NZ_CP042930|CRT matches to NZ_CP022055 (Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

ggcgtcagcgtctgcatctgaatcagcatcagcgtcggcg	CRISPR spacer
tgaatcagcatctgcatctgaatcagcatctgcgtctgaa	Protospacer
 * .*****.******************** ***** * .

2871. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcgtcagcg	Protospacer
 **.*****************.**** .**.* .

2872. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcatccgcatccgcatcggcgtcagcg	Protospacer
.*********** ********.**** .**.* .

2873. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcgtccgcg	Protospacer
 **.*****************.**** .** * .

2874. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcgtccgcg	Protospacer
 **.*****************.**** .** * .

2875. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgcatcggcgtcagcatctgcgtcggcgtcagcg	Protospacer
 ********.********.******* .**.* .

2876. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcgtcggcatcagcatccgcatcggcgtccgcg	Protospacer
 **.*****************.**** .** * .

2877. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
ggcatcggcgtcagcatccgcatcggcgtccgcg	Protospacer
.********.***********.**** .** * .

2878. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gacggcgtcgtcggcatcggcatcggcatcggca	Protospacer
*.*. *  *.******** *********** ***

2879. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcaaagatg	Protospacer
****** *********** *********   ...

2880. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcaaagatg	Protospacer
****** *********** *********   ...

2881. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcaaagatg	Protospacer
****** *********** *********   ...

2882. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
tgcatctgcatcggcatcggcatcgacgatcgcg	Protospacer
 *****.*********** ******.*. .***.

2883. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcggagccg	Protospacer
****** *********** ********.    *.

2884. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggccggggag	Protospacer
****** *********** ********    * .

2885. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca-----	CRISPR spacer
ggcatcggcatcggcatcggcatcg-----cgcgacatg	Protospacer
****** *********** ******     ***.     

2886. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ctcaaccgcaacggcatccgcatcggcagcgccg	Protospacer
  ** ***** ***************** *  *.

2887. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatgcgcatcggcaaccgcatcgccggcgacg	Protospacer
***** ********** ******** *. * .*.

2888. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcggcatcatcggcatccgcatcatcatccgaa	Protospacer
 **. *  ****************. ****** *

2889. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.765

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgcggcatcatcggcatccgcatcatcatccgaa	Protospacer
 **. *  ****************. ****** *

2890. spacer 3.28|3324012|28|NZ_CP042930|CRT matches to CP003674 (Staphylococcus warneri SG1 plasmid clone pvSw5 genomic sequence) position: , mismatch: 8, identity: 0.714

agcgtctgcatcggcgtctgcatcggcg	CRISPR spacer
agcgtctgcatcggcgtcggcg------	Protospacer
****************** **.      

2891. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.765

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
atcatcatcatccgcttcggcatcagccggtcca	Protospacer
* ***** ******* ***********   * *.

2892. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgagtcagcatctgcatcggcatctgcgtcggcatccgcg	Protospacer
.* .** ********************.******** * .

2893. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgagtcagcatctgcatcggcatctgcgtcggcatccgcg	Protospacer
.* .** ********************.******** * .

2894. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgagtcagcatctgcatcggcatctgcgtcggcatccgcg	Protospacer
.* .** ********************.******** * .

2895. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgagtcagcatctgcatcggcatctgcgtcggcatccgcg	Protospacer
.* .** ********************.******** * .

2896. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgagtcagcatctgcatcggcatctgcgtcggcatccgcg	Protospacer
.* .** ********************.******** * .

2897. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgagtcagcatctgcatcggcatctgcgtcggcatccgcg	Protospacer
.* .** ********************.******** * .

2898. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
ggcatctgcatctgcatcggcatctgaatcttcttcgaag	Protospacer
 ************************* ***  * **..*.

2899. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.8

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
gccgtcgccatctgcatctgcatctgcatcggcatcggca	Protospacer
  *.**  ********** *****************.* *

2900. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatctgcatccgcgtcggcatccgcatcggcgtccgca	Protospacer
************ ***** ***********.* .** * .

2901. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatctgcatccgcgtcggcatccgcatcggcgtccgca	Protospacer
************ ***** ***********.* .** * .

2902. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
cgcatctgcatccgcgtcggcatccgcatcggcgtcagcg	Protospacer
 *********** ***** ***********.* .**.* *

2903. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatccgcatcggcgtcggcatccgcatctgcgtcagca	Protospacer
******.*********** *********** * .**.* .

2904. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
tgcatccgcatcggcgtccgcatcggcatctgcgtccgcg	Protospacer
 *****.***************** ***** * .** * *

2905. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
tgcatccgcatcggcgtccgcatcggcatctgcgtccgcg	Protospacer
 *****.***************** ***** * .** * *

2906. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatccgcatcggcgtcggcatccgcatcggcgtcagca	Protospacer
******.*********** ***********.* .**.* .

2907. spacer 3.43|3324768|40|NZ_CP042930|CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 8, identity: 0.8

ggcatctgcatcggcgtccgcatccgcatcagaatcggag	CRISPR spacer
ggcatctgcatccgcgtcggcatccgcatcggcgtccgca	Protospacer
************ ***** ***********.* .** * .

2908. spacer 3.49|3325182|28|NZ_CP042930|CRT matches to GU943040 (Uncultured phage MedDCM-OCT-S09-C28 genomic sequence) position: , mismatch: 8, identity: 0.714

agcatccgcatctgcatcagcgtctgaa	CRISPR spacer
tgcatccgcgtctgcatcagcgatgttg	Protospacer
 ********.************ .   .

2909. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MK552105 (Escherichia phage Jahat_MG145, complete genome) position: , mismatch: 8, identity: 0.75

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
ttgttggttcctgtgctggcgctggcgttcca	Protospacer
 *. ******* **************** .  

2910. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_KX786187 (Enterobacter cloacae strain N14-0444 plasmid pIMI-6, complete sequence) position: , mismatch: 8, identity: 0.75

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

2911. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_KT225520 (Raoultella ornithinolytica strain RJ46C plasmid pRJ46C, complete sequence) position: , mismatch: 8, identity: 0.75

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

2912. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to KT780723 (Uncultured bacterium plasmid pGA45, complete sequence) position: , mismatch: 8, identity: 0.75

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

2913. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 8, identity: 0.75

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
attctggtgccgatgctggcgctggcgcacgc	Protospacer
.*  **** ***.**************.*..*

2914. spacer 6.4|3729152|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 8, identity: 0.75

gtttgacgtgaagagttatcagtataattctt	CRISPR spacer
gtcgcaggtgaagagttatcagaagaattccg	Protospacer
**.  * *************** * *****. 

2915. spacer 6.10|3729519|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcatatatctgcgaagcggctg----tggttgcg	CRISPR spacer
acgcatacatccgcgaagcggctggcaacggt----	Protospacer
 ******.***.************    .***    

2916. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to MH791398 (UNVERIFIED: Aeromonas phage Asswx_1, complete genome) position: , mismatch: 8, identity: 0.75

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
ccccaagaatccatagctgattcgatttctga	Protospacer
 .. ********** ******* ******..*

2917. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to MN871442 (UNVERIFIED: Aeromonas phage Aszh-1, complete genome) position: , mismatch: 8, identity: 0.75

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
ccccaagaatccatagctgattcgatttctga	Protospacer
 .. ********** ******* ******..*

2918. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to MN871441 (UNVERIFIED: Aeromonas phage AsSzw2, complete genome) position: , mismatch: 8, identity: 0.75

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
ccccaagaatccatagctgattcgatttctga	Protospacer
 .. ********** ******* ******..*

2919. spacer 6.31|3730797|32|NZ_CP042930|PILER-CR matches to MT375524 (Pelagibacter phage Gjalp EXVC02, partial genome) position: , mismatch: 8, identity: 0.75

tctggttatattcaataaagcctgacggtacg	CRISPR spacer
cttggttatattcactaaagtctgagtgttct	Protospacer
..************ *****.****  ** * 

2920. spacer 6.31|3730797|32|NZ_CP042930|PILER-CR matches to MT375523 (Pelagibacter phage Eyrgjafa EXV, complete genome) position: , mismatch: 8, identity: 0.75

tctggttatattcaataaagcctgacggtacg	CRISPR spacer
cttggttatattcactaaagtctgagtgttct	Protospacer
..************ *****.****  ** * 

2921. spacer 6.32|3730858|32|NZ_CP042930|PILER-CR matches to NZ_CP028237 (Lactobacillus plantarum strain SRCM101511 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tatcgtgatgatgtatcggcagaatctaaatg	CRISPR spacer
agtttagatgatgtatcggcagaatttaatta	Protospacer
 .*.  *******************.*** *.

2922. spacer 6.33|3730919|32|NZ_CP042930|PILER-CR matches to KP282678 (Sulfolobus monocaudavirus SMV4, complete genome) position: , mismatch: 8, identity: 0.75

tgtgccagcagtccaagttcggagccgaaatt----	CRISPR spacer
cgtgccagcagaccaagttgggagc----gttacag	Protospacer
.********** ******* *****    .**    

2923. spacer 6.33|3730919|32|NZ_CP042930|PILER-CR matches to NC_028865 (Tsukamurella phage TIN2, complete genome) position: , mismatch: 8, identity: 0.75

tgtgccagcagtccaagttcggagccgaaatt	CRISPR spacer
tgtgccagcagtcgaagttcgtagtctcgacg	Protospacer
************* ******* **.*  .*. 

2924. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MH791398 (UNVERIFIED: Aeromonas phage Asswx_1, complete genome) position: , mismatch: 8, identity: 0.75

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
ccccaagaatccatagctgattcgatttctga	Protospacer
 .. ********** ******* ******..*

2925. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MN871442 (UNVERIFIED: Aeromonas phage Aszh-1, complete genome) position: , mismatch: 8, identity: 0.75

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
ccccaagaatccatagctgattcgatttctga	Protospacer
 .. ********** ******* ******..*

2926. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MN871441 (UNVERIFIED: Aeromonas phage AsSzw2, complete genome) position: , mismatch: 8, identity: 0.75

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
ccccaagaatccatagctgattcgatttctga	Protospacer
 .. ********** ******* ******..*

2927. spacer 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MT375524 (Pelagibacter phage Gjalp EXVC02, partial genome) position: , mismatch: 8, identity: 0.75

tctggttatattcaataaagcctgacggtacg	CRISPR spacer
cttggttatattcactaaagtctgagtgttct	Protospacer
..************ *****.****  ** * 

2928. spacer 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MT375523 (Pelagibacter phage Eyrgjafa EXV, complete genome) position: , mismatch: 8, identity: 0.75

tctggttatattcaataaagcctgacggtacg	CRISPR spacer
cttggttatattcactaaagtctgagtgttct	Protospacer
..************ *****.****  ** * 

2929. spacer 6.56|3730845|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_CP028237 (Lactobacillus plantarum strain SRCM101511 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tatcgtgatgatgtatcggcagaatctaaatg	CRISPR spacer
agtttagatgatgtatcggcagaatttaatta	Protospacer
 .*.  *******************.*** *.

2930. spacer 6.57|3730906|32|NZ_CP042930|CRT,CRISPRCasFinder matches to KP282678 (Sulfolobus monocaudavirus SMV4, complete genome) position: , mismatch: 8, identity: 0.75

tgtgccagcagtccaagttcggagccgaaatt----	CRISPR spacer
cgtgccagcagaccaagttgggagc----gttacag	Protospacer
.********** ******* *****    .**    

2931. spacer 6.57|3730906|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_028865 (Tsukamurella phage TIN2, complete genome) position: , mismatch: 8, identity: 0.75

tgtgccagcagtccaagttcggagccgaaatt	CRISPR spacer
tgtgccagcagtcgaagttcgtagtctcgacg	Protospacer
************* ******* **.*  .*. 

2932. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 9, identity: 0.735

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tcgctcggcatccgcatcggcgtcggcatccgca	Protospacer
  . **************.***** ***** * .

2933. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.735

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
gccatctgcatccgcatcagcgtctccatcgcca	Protospacer
.  *** ****************** ****.  .

2934. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 9, identity: 0.735

agaatcggc--atccgcatcagcgtctgcatcagag	CRISPR spacer
--gggcgactgatccggatcagcgtctgcatctgaa	Protospacer
  .. **.*  ***** *************** **.

2935. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggca------	Protospacer
       ***************** *****.***      

2936. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggca------	Protospacer
       ***************** *****.***      

2937. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggca------	Protospacer
       ***************** *****.***      

2938. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctccgccaaca	Protospacer
****.**********.********  *..*..*.

2939. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctccgccaaca	Protospacer
****.**********.********  *..*..*.

2940. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctccgccaaca	Protospacer
****.**********.********  *..*..*.

2941. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
gacctgcttttcggcagcggcatcagcatcggcg	Protospacer
*.* *   . ****** * ***************

2942. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
catgtaggggtcggcctctgcatcggcatcggcg	Protospacer
 ...* ** .***** ********.*********

2943. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctccgccaaca	Protospacer
****.**********.********  *..*..*.

2944. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctccgccaaca	Protospacer
****.**********.********  *..*..*.

2945. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_LT559121 (Nonomuraea gerenzanensis isolate nono1 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.735

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
cagttgaggatcagcgtcagcgtcagcagcagcg	Protospacer
..  *  * ******************. *****

2946. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.735

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tgcttctgcagcagcgtcagcgtcgcctcatggg	Protospacer
*** ****** *************. * .  * *

2947. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 9, identity: 0.735

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tgcttctgcagcagcgtcagcgtcgcctcatggg	Protospacer
*** ****** *************. * .  * *

2948. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 9, identity: 0.735

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
tgcttctgcagcagcgtcagcgtcgcctcatggg	Protospacer
*** ****** *************. * .  * *

2949. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to CP000664 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence) position: , mismatch: 9, identity: 0.735

tgcatctgca-----tcagcgtcagcgtcagcgtcagcg	CRISPR spacer
-----ccgcgggccctcagggtcagcgtcagcgtcaccg	Protospacer
     *.**.     **** **************** **

2950. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to MK448808 (Streptococcus phage Javan569, complete genome) position: , mismatch: 9, identity: 0.679

ggcatcggcatccgcatcggcatcagca------	CRISPR spacer
------tccatccgcatcggcatcggcatcacag	Protospacer
        ****************.***      

2951. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to MK448807 (Streptococcus phage Javan567, complete genome) position: , mismatch: 9, identity: 0.679

ggcatcggcatccgcatcggcatcagca------	CRISPR spacer
------tccatccgcatcggcatcggcatcacag	Protospacer
        ****************.***      

2952. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to MK448991 (Streptococcus phage Javan590, complete genome) position: , mismatch: 9, identity: 0.679

ggcatcggcatccgcatcggcatcagca------	CRISPR spacer
------tccatccgcatcggcatcggcatcacag	Protospacer
        ****************.***      

2953. spacer 3.16|3323220|28|NZ_CP042930|CRT matches to MK448805 (Streptococcus phage Javan563, complete genome) position: , mismatch: 9, identity: 0.679

ggcatcggcatccgcatcggcatcagca------	CRISPR spacer
------tccatccgcatcggcatcggcatcacag	Protospacer
        ****************.***      

2954. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgacgcggcaccagcatgcgcgtcggaatcgagc	Protospacer
 *   *****.****** *************.. 

2955. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgacgcggcaccagcatgcgcgtcggaatcgagc	Protospacer
 *   *****.****** *************.. 

2956. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.735

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
tgacgcggcaccagcatgcgcgtcggaatcgagc	Protospacer
 *   *****.****** *************.. 

2957. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 9, identity: 0.735

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cgcatcggcatccgcatccgcgccggcaatgccg	Protospacer
 *********** *********.*** * .*  .

2958. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2959. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2960. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2961. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2962. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2963. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2964. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2965. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2966. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2967. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2968. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2969. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2970. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2971. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2972. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2973. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2974. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2975. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2976. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2977. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2978. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2979. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2980. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2981. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2982. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2983. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2984. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2985. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2986. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2987. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2988. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2989. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2990. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2991. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2992. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2993. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2994. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

2995. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2996. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2997. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

2998. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

2999. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3000. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3001. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3002. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3003. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3004. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3005. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3006. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3007. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3008. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3009. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3010. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3011. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3012. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3013. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3014. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3015. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3016. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3017. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3018. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3019. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3020. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3021. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3022. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3023. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccattgcgcatccgcatccgcatccgcatccgca------	Protospacer
       *********** *********** ***      

3024. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3025. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3026. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3027. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3028. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3029. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3030. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3031. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgccgggcta	Protospacer
      ****** *********** ********       

3032. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcgagattgtgg	Protospacer
****** *********** ******. **.   .

3033. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3034. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3035. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcgggtgggccg	Protospacer
****** *********** *******      *.

3036. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcggcgatgatg	Protospacer
****** *********** ********. . ...

3037. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3038. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3039. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3040. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3041. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3042. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3043. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3044. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3045. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3046. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3047. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3048. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3049. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3050. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3051. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3052. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3053. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3054. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3055. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3056. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3057. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3058. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3059. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------cgcatccgcatccgcatccgcatccgcccgcacc	Protospacer
      ****** *********** ********       

3060. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

-ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
gtgtgaccat-tccgcatccgcatccgcatccgca	Protospacer
  *.. **.. ** *********** *********

3061. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cggctgtccatcgccacccgcatcggcatccgcc	Protospacer
 *  * . ***** **.**************** 

3062. spacer 3.29|3324060|34|NZ_CP042930|CRT matches to NZ_MF600313 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence) position: , mismatch: 9, identity: 0.735

agcatcagcatccgcgtcggcatcagcatctgcg	CRISPR spacer
agcatcagcatcagcatcggcatcgagaggatcg	Protospacer
************ **.********.. *    **

3063. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.735

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
tgacgcggcaccagcatgcgcgtcggaatcgagc	Protospacer
.*   *****.****** *************.  

3064. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
tgacgcggcaccagcatgcgcgtcggaatcgagc	Protospacer
.*   *****.****** *************.  

3065. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
tgacgcggcaccagcatgcgcgtcggaatcgagc	Protospacer
.*   *****.****** *************.  

3066. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.735

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
cttgcgggcttcagcatccgcgtcggtatcgccc	Protospacer
* ... *** **************** **** * 

3067. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.775

cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
tgcatctgcatctgcatcggcatcggcatcgacgatcgcg	Protospacer
.*********************** ******.*. . * .

3068. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.735

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
agcagtgcagtcagcgtcacaatcggcgtcagcg	Protospacer
 *** .   .**.****** **************

3069. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
ccgatggcggtcggcgtcagcatcggcgtaagcg	Protospacer
*  **    .********** ******** ****

3070. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to MN855676 (Bacteriophage sp. isolate 104, complete genome) position: , mismatch: 9, identity: 0.735

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
aggctctccatcgccgtcagaatcgccgtcagtc	Protospacer
 *  **. ***** *********** ******. 

3071. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 9, identity: 0.775

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agattcagagtcagagtcagagtcagagtcagaggcagcg	Protospacer
      *** ***********************.**.***      

3072. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 9, identity: 0.775

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agattcagagtcagagtcagagtcagagtcagaggcagcg	Protospacer
      *** ***********************.**.***      

3073. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.775

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agattcagagtcagagtcagagtcagagtcagaggcagcg	Protospacer
      *** ***********************.**.***      

3074. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 9, identity: 0.775

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agattcagagtcagagtcagagtcagagtcagaggcagcg	Protospacer
      *** ***********************.**.***      

3075. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.775

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agattcagagtcagagtcagagtcagagtcagaggcagcg	Protospacer
      *** ***********************.**.***      

3076. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP028270 (Pediococcus pentosaceus strain SRCM102740 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

3077. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP028267 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

3078. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

3079. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP028265 (Pediococcus pentosaceus strain SRCM102738 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

3080. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP031004 (Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

3081. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP021928 (Pediococcus pentosaceus strain SRCM100194 plasmid pPP194-2, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

3082. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gaggtggtgccgctgctggcgctggcgtggca	Protospacer
* ..**** *** ***************.   

3083. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
atccaggtgccggtgctggcgatggcgtgcat	Protospacer
.*   *** ************ ******..*.

3084. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN693890 (Marine virus AFVG_250M637, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *  

3085. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN693630 (Marine virus AFVG_250M640, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *  

3086. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN693538 (Marine virus AFVG_25M196, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
ctgacggttctggtgctggcactggcgttgtt	Protospacer
 *.*.*****.*********.*******   .

3087. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN693980 (Marine virus AFVG_250M1182, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *  

3088. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN694080 (Marine virus AFVG_250M639, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *  

3089. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN694696 (Marine virus AFVG_250M540, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
tatctggttccggtgcaggtgctggcgc-tgca	Protospacer
    ************ **.*******. *.* 

3090. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN694192 (Marine virus AFVG_250M638, complete genome) position: , mismatch: 9, identity: 0.719

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *  

3091. spacer 6.3|3729091|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

tcccgctgccgcgcgtcccaccgcgcgatatc	CRISPR spacer
ggcagctccggcgcgtcccaccgcgcgcgcac	Protospacer
  * *** * *****************    *

3092. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP025884 (Escherichia coli strain 503440 plasmid p503440_78, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3093. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP025893 (Escherichia coli strain 503025 plasmid p503025_105, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3094. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP025866 (Escherichia coli strain 504211 plasmid p504211_78, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3095. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP025872 (Escherichia coli strain 503829 plasmid p503829_77, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3096. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP025914 (Escherichia coli strain 203740 plasmid p203740_80, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3097. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP024231 (Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3098. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP006002 (Escherichia coli B7A plasmid pEB4, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3099. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to CP025899 (Escherichia coli strain 500465 plasmid p500465_77, complete sequence) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3100. spacer 6.5|3729213|32|NZ_CP042930|CRISPRCasFinder,CRT matches to LN908839 (Escherichia coli plasmid pCss_E1189) position: , mismatch: 9, identity: 0.719

ttattttatccctgtaataatgctaatggatg	CRISPR spacer
gttacttatacctttaataatgctaatggtca	Protospacer
 *  .**** *** *************** ..

3101. spacer 6.13|3729703|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021746 (Agarilytica rhodophyticola strain 017 plasmid pSU2, complete sequence) position: , mismatch: 9, identity: 0.719

agccactggcaaaataaaccatacccagcgac	CRISPR spacer
ggccacttacaaaataaaccatacagaagttc	Protospacer
.****** .***************  *.   *

3102. spacer 6.15|3729825|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 9, identity: 0.719

gcgttattgaataaagcactggattgtttttt	CRISPR spacer
taatggttgaattaagcacaggattgtttgta	Protospacer
  .* .****** ****** ********* * 

3103. spacer 6.16|3729886|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NC_048687 (Pseudomonas phage PMBT14, complete genome) position: , mismatch: 9, identity: 0.719

gtcgg--tattggtgttcgggtttagctgccggg	CRISPR spacer
--cagctctctggtgttcgggttttgctggcggt	Protospacer
  *.*  . .************** **** *** 

3104. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KC691254 (Mycobacterium phage Breezona, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3105. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MF140422 (Mycobacterium phage Nicholasp3, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3106. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MN586052 (Mycobacterium phage Kahlid, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3107. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MK937600 (Mycobacterium phage Wigglewiggle, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3108. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MN234228 (Mycobacterium phage Tourach, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3109. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MN586030 (Mycobacterium phage BobsGarage, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3110. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MN703406 (Mycobacterium phage Gabriela, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3111. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MF324910 (Mycobacterium phage GuuelaD, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3112. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MH834600 (Mycobacterium phage BigCheese, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3113. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NC_031124 (Mycobacterium phage Gardann, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3114. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KC661276 (Mycobacterium phage Winky, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3115. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NC_022071 (Mycobacterium phage Crossroads, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3116. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MN096380 (Mycobacterium phage Lewan, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3117. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MF185730 (Mycobacterium phage Miley16, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3118. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MF185728 (Mycobacterium phage Finemlucis, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3119. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KX580962 (Mycobacterium phage Wilder, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3120. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KU997639 (Mycobacterium phage Loadrie, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3121. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KX580961 (Mycobacterium phage Zakai, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3122. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MN703410 (Mycobacterium phage Itos, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3123. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to MH779511 (Mycobacterium phage LilDestine, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3124. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to NC_015584 (Mycobacterium virus Faith1, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3125. spacer 6.17|3729947|32|NZ_CP042930|CRISPRCasFinder,CRT,PILER-CR matches to KU234099 (Mycobacterium phage MkaliMitinis3, complete genome) position: , mismatch: 9, identity: 0.719

atctggtcgctggtcaaactcccaatctgcgc	CRISPR spacer
ttctggtcactggtcaagctcccaaggcaggt	Protospacer
 *******.********.*******  .. *.

3126. spacer 6.31|3730797|32|NZ_CP042930|PILER-CR matches to NZ_CP017589 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ08, complete sequence) position: , mismatch: 9, identity: 0.719

tctggttatattcaataaagcctgacggtacg	CRISPR spacer
ttacctattattcaacaaagcccgacggtaca	Protospacer
*.   *  *******.******.********.

3127. spacer 6.36|3731102|32|NZ_CP042930|PILER-CR matches to NZ_LR135354 (Enterococcus faecium isolate E8014 plasmid 4) position: , mismatch: 9, identity: 0.719

tgccacagatgaagagacaagccagttaatgg	CRISPR spacer
accttttgatgaagagagaagtcagttaatgc	Protospacer
  *. . ********** ***.********* 

3128. spacer 6.36|3731102|32|NZ_CP042930|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 9, identity: 0.719

tgccacagatgaagagacaagccagttaatgg	CRISPR spacer
accttttgatgaagagagaagtcagttaatgc	Protospacer
  *. . ********** ***.********* 

3129. spacer 6.41|3731408|32|NZ_CP042930|PILER-CR matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggtgccggtgctgagacactgccccaggg	CRISPR spacer
cgacccgccggtgcggcgacactgccccagcc	Protospacer
 *   .******** * *************  

3130. spacer 6.55|3730784|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_CP017589 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ08, complete sequence) position: , mismatch: 9, identity: 0.719

tctggttatattcaataaagcctgacggtacg	CRISPR spacer
ttacctattattcaacaaagcccgacggtaca	Protospacer
*.   *  *******.******.********.

3131. spacer 6.60|3731089|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_LR135354 (Enterococcus faecium isolate E8014 plasmid 4) position: , mismatch: 9, identity: 0.719

tgccacagatgaagagacaagccagttaatgg	CRISPR spacer
accttttgatgaagagagaagtcagttaatgc	Protospacer
  *. . ********** ***.********* 

3132. spacer 6.60|3731089|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 9, identity: 0.719

tgccacagatgaagagacaagccagttaatgg	CRISPR spacer
accttttgatgaagagagaagtcagttaatgc	Protospacer
  *. . ********** ***.********* 

3133. spacer 6.65|3731395|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggtgccggtgctgagacactgccccaggg	CRISPR spacer
cgacccgccggtgcggcgacactgccccagcc	Protospacer
 *   .******** * *************  

3134. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg------	CRISPR spacer
------ggtatcggcatcggcatcggcatcggtggtgcgg	Protospacer
      **.********* *****.*******.*      

3135. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP015734 (Arthrobacter sp. U41 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg------	CRISPR spacer
------ggcattggcatcggcatcggcatcggtgcgtctc	Protospacer
      *****.****** *****.*******.*      

3136. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg------	CRISPR spacer
------ccgatcggcatcggcatcagcatcggcgtggcga	Protospacer
         ********* ***************      

3137. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcatcggcatcgtggccaatg	Protospacer
****.************* *****.  ..*...*

3138. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3139. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3140. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3141. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3142. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3143. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3144. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3145. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3146. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3147. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3148. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3149. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3150. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3151. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3152. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3153. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3154. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3155. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3156. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3157. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3158. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3159. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3160. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3161. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3162. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3163. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
ggcaccggcatcggcgtctgcatctcggccaaca	Protospacer
****.**********.********   ..*..*.

3164. spacer 3.13|3323046|34|NZ_CP042930|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.706

tgcatctgcatcagcgtcagcgtcagcgtcagcg	CRISPR spacer
gcggtctgcttcatcgtcagcgtcagcgcgacgg	Protospacer
   .***** *** **************. *  *

3165. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaatattact	Protospacer
****** *********** ******.   ...* 

3166. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaatattact	Protospacer
****** *********** ******.   ...* 

3167. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 10, identity: 0.706

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ggcatcggcatcggcatcggcatcgaatattact	Protospacer
****** *********** ******.   ...* 

3168. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to MF140404 (Arthrobacter phage Christian, complete genome) position: , mismatch: 10, identity: 0.706

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
attactaagatcaacatcctcgtcggaatcggca	Protospacer
  .*.... ****.***** **************

3169. spacer 3.30|3324114|34|NZ_CP042930|CRT matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 10, identity: 0.706

cgcatcggcatcagcatccgcgtcggaatcggca	CRISPR spacer
attactaagatcaacatcctcgtcggaatcggca	Protospacer
  .*.... ****.***** **************

3170. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.75

------cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
gccatctgcatctgcatctgcatcggcatcggcatcgacg------	Protospacer
      .*********************** ******.*.      

3171. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 10, identity: 0.75

------cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggcatcggca------	Protospacer
      .***** ***** *********** *********      

3172. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 10, identity: 0.75

------cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggcatcggca------	Protospacer
      .***** ***** *********** *********      

3173. spacer 3.40|3324606|40|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 10, identity: 0.75

------cgcatctgcatctgcatcggcatctgcatcggcatcagaa	CRISPR spacer
acccactgcatcggcatcggcatcggcatcggcatcggca------	Protospacer
      .***** ***** *********** *********      

3174. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to NZ_CP021660 (Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-1, complete sequence) position: , mismatch: 10, identity: 0.706

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
catcgccgcatcggcggcaggatcggcgtagact	Protospacer
*..  *********** ***.******** ..* 

3175. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagagtcagagtcagagtcagaggcagcggaagag	Protospacer
      ***************************. *.* *      

3176. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagagtcagagtcagagtcagaggcagcggaagag	Protospacer
      ***************************. *.* *      

3177. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagagtcagagtcagagtcagaggcagcggaagag	Protospacer
      ***************************. *.* *      

3178. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagagtcagagtcagagtcagaggcagcggaagag	Protospacer
      ***************************. *.* *      

3179. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagagtcagagtcagagtcagaggcagcggaagag	Protospacer
      ***************************. *.* *      

3180. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagattcagagtcagagtcagaggcagaggaagag	Protospacer
      ********* *****************. *.***      

3181. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 10, identity: 0.75

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agagtcagattcagagtcagagtcagaggcagaggaagag	Protospacer
      ********* *****************. *.***      

3182. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 10, identity: 0.688

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..  

3183. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..  

3184. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..  

3185. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 10, identity: 0.688

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..  

3186. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 10, identity: 0.688

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcggtggtgccggtggtggcgctggcggcggt	Protospacer
*...**** ****** ***********   ..

3187. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to KJ944830 (Pseudoalteromonas phage B8b, partial genome) position: , mismatch: 10, identity: 0.688

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcgctggtgctggtgctggcgctggcgctggt	Protospacer
*.. **** *.****************.  ..

3188. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.688

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
cccacgacctcaatcgctgattggctttccaa	Protospacer
 ..* ..  ** ************ *******

3189. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.688

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
cccacgacctcaatcgctgattggctttccaa	Protospacer
 ..* ..  ** ************ *******

3190. spacer 6.29|3730675|32|NZ_CP042930|PILER-CR matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 10, identity: 0.688

tagtcctgcggcctgccctagctgggtaggca	CRISPR spacer
ataacctgcggcctgcgccagctgggtcgcgg	Protospacer
  . ************ *.******** *  .

3191. spacer 6.32|3730858|32|NZ_CP042930|PILER-CR matches to MH617645 (Inoviridae sp. isolate ctcb11, complete genome) position: , mismatch: 10, identity: 0.688

tatcgtgatgatgtatcggcagaatctaaatg	CRISPR spacer
gctgctgttgatgtatcggcagaagctaccgc	Protospacer
  *  ** **************** ***    

3192. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.688

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
cccacgacctcaatcgctgattggctttccaa	Protospacer
 ..* ..  ** ************ *******

3193. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.688

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
cccacgacctcaatcgctgattggctttccaa	Protospacer
 ..* ..  ** ************ *******

3194. spacer 6.53|3730662|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 10, identity: 0.688

tagtcctgcggcctgccctagctgggtaggca	CRISPR spacer
ataacctgcggcctgcgccagctgggtcgcgg	Protospacer
  . ************ *.******** *  .

3195. spacer 6.56|3730845|32|NZ_CP042930|CRT,CRISPRCasFinder matches to MH617645 (Inoviridae sp. isolate ctcb11, complete genome) position: , mismatch: 10, identity: 0.688

tatcgtgatgatgtatcggcagaatctaaatg	CRISPR spacer
gctgctgttgatgtatcggcagaagctaccgc	Protospacer
  *  ** **************** ***    

3196. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcggcggcatcggcatctgcgtctgcatgtcga	Protospacer
 * . ******* ***** **********   ..

3197. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
tgcggcggcatcggcatctgcgtctgcatgtcga	Protospacer
 * . ******* ***** **********   ..

3198. spacer 3.6|3322668|34|NZ_CP042930|CRT matches to NZ_AP022339 (Mameliella alba strain KU6B plasmid pKUB112, complete sequence) position: , mismatch: 11, identity: 0.676

agaatcggcatccgcatcagcgtctgcatcagag	CRISPR spacer
cccgcgtgcatccgcatcatcatctgcatcatgg	Protospacer
   ..  ************ *.********* .*

3199. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP045838 (Citrobacter sp. H12-3-2 plasmid pH12-1, complete sequence) position: , mismatch: 11, identity: 0.676

ggcatcggcatcggcatctgcatcagcatcggcg------	CRISPR spacer
------ggcatcggcatcggcatcggcatcgaatattact	Protospacer
      ************ *****.******.        

3200. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_MK167988 (Citrobacter freundii strain TS45CTX plasmid pHNTS45-1, complete sequence) position: , mismatch: 11, identity: 0.676

ggcatcggcatcggcatctgcatcagcatcggcg------	CRISPR spacer
------ggcatcggcatcggcatcggcatcgaatattact	Protospacer
      ************ *****.******.        

3201. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 11, identity: 0.676

ggcatcggcatcggcatctgcatcagcatcggcg------	CRISPR spacer
------ggcatcggcatcggcatcggcatcgaatattact	Protospacer
      ************ *****.******.        

3202. spacer 3.22|3323622|58|NZ_CP042930|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 11, identity: 0.81

tgcatctgcgtcagcg----tcggcatccgcatccgcatcggcatccgcatcggcgtcag	CRISPR spacer
----tccgcgtcggcatcgctcggcatccgcatcggcgtcggcatccgcatcggcgtcag	Protospacer
    **.*****.**.    ************** **.**********************

3203. spacer 3.25|3323844|34|NZ_CP042930|CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 11, identity: 0.676

agcatcggcatcagcatccgcgtcggaatcggaa	CRISPR spacer
cttgcgggcttcagcatccgcgtcggtatcgccc	Protospacer
  ... *** **************** ****   

3204. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccatgtcgtgtcggcatcggcatcggcatcggca------	Protospacer
       *..** *********** *********      

3205. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
cgggtccgcatcggcatccacgtcggcaagtcgg	Protospacer
 * .***************.*.******  .  .

3206. spacer 3.47|3325050|40|NZ_CP042930|CRT matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.725

cgcgtcagagtcagagtcagagtcagagtcagaatcggag------	CRISPR spacer
------agattcagagtcagattcagagtcagaggcagaggaagag	Protospacer
      *** *********** ***********. *.***      

3207. spacer 6.2|3729030|32|NZ_CP042930|CRISPRCasFinder,CRT matches to NZ_CP041164 (Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
acggtggtgccggtgctggcgctgtcgctgct	Protospacer
....**** *************** **.   .

3208. spacer 6.20|3730124|32|NZ_CP042930|PILER-CR matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 11, identity: 0.656

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
agagaagaaaccatcgctgattgtattagatg	Protospacer
.  .***** ************* ***    .

3209. spacer 6.44|3730111|32|NZ_CP042930|CRT,CRISPRCasFinder matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 11, identity: 0.656

gttaaagaatccatcgctgattggatttccaa	CRISPR spacer
agagaagaaaccatcgctgattgtattagatg	Protospacer
.  .***** ************* ***    .

3210. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.647

------ggcatccgcatcggcatccgcatcggcatccgca	CRISPR spacer
ccatgtcgtatcggcatcggcatcggcatcgggt------	Protospacer
       *.*** *********** *******        

3211. spacer 3.27|3323958|34|NZ_CP042930|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 12, identity: 0.647

ggcatccgcatcggcatccgcatcggcatccgca------	CRISPR spacer
------ccgatcggcatcggcatcagcatcggcgtggcga	Protospacer
      *  ********* *****.***** **.      

3212. spacer 3.46|3324996|34|NZ_CP042930|CRT matches to MT028492 (Ochrobactrum phage vB_OspP_OH, complete genome) position: , mismatch: 12, identity: 0.647

cgcatccgcatcggcgtcagaatcggcgtcagcg	CRISPR spacer
aagcgacgcatcggcgtcgtaatcggcgtcgatt	Protospacer
 .    ************. **********... 

3213. spacer 3.12|3322992|34|NZ_CP042930|CRT matches to NZ_CP020386 (Rhodovulum sp. MB263 plasmid pRSMBB, complete sequence) position: , mismatch: 14, identity: 0.588

------ggcatcggcatcggcatctgcatcagcatcggcg	CRISPR spacer
tctgagatgatcggcctcagcatcagcatcggct------	Protospacer
      .  ****** **.***** *****.**       

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1815886 : 1856439 54 Salmonella_phage(24.44%) capsid,portal,tRNA,tail,head,protease,terminase,integrase attL 1807022:1807036|attR 1832925:1832939
DBSCAN-SWA_2 2037284 : 2135126 106 Enterobacteria_phage(39.62%) capsid,portal,tRNA,tail,head,lysis,protease,terminase NA
DBSCAN-SWA_3 2155095 : 2168866 14 Escherichia_phage(11.11%) NA NA
DBSCAN-SWA_4 2329404 : 2339044 9 Ralstonia_phage(83.33%) NA NA
DBSCAN-SWA_5 3640576 : 3648024 7 Mycobacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage