Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043027 Salmonella enterica subsp. enterica strain AD19 chromosome, complete genome 2 crisprs DEDDh,WYL,DinG,cas3,csa3,cas2,cas1,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 10 9 0

Results visualization

1. NZ_CP043027
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043027_1 3899095-3899672 TypeI-E I-E
9 spacers
cas2,cas1,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043027_2 3915918-3916312 TypeI-E I-E
6 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 609728-609759 7 0.781
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1851451-1851482 7 0.781
NZ_CP043027_1 1.9|3899612|32|NZ_CP043027|CRISPRCasFinder,CRT,PILER-CR 3899612-3899643 32 MK524177 Escherichia phage PHB10, complete genome 42715-42746 7 0.781
NZ_CP043027_2 2.7|3916069|31|NZ_CP043027|PILER-CR 3916069-3916099 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2119054-2119084 7 0.774
NZ_CP043027_2 2.7|3916069|31|NZ_CP043027|PILER-CR 3916069-3916099 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2187008-2187038 7 0.774
NZ_CP043027_2 2.7|3916069|31|NZ_CP043027|PILER-CR 3916069-3916099 31 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 1156913-1156943 8 0.742
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_LN997849 Magnetospirillum sp. XM-1 isolate XM1 plasmid II, complete sequence 25343-25374 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MK837010 Pseudomonas virus Pa204, complete genome 2999-3030 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871485 UNVERIFIED: Pseudomonas phage PaSz-8_45_66k, complete genome 5286-5317 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871468 UNVERIFIED: Pseudomonas phage Pa-Q, complete genome 8244-8275 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871473 UNVERIFIED: Pseudomonas virus Pa-Z, complete genome 56927-56958 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MT413450 Pseudomonas phage Epa15, complete genome 33251-33282 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871479 UNVERIFIED: Pseudomonas phage PaSt-2_45_65k, complete genome 54791-54822 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871464 UNVERIFIED: Pseudomonas phage Pa-M, complete genome 32939-32970 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MT118290 Pseudomonas phage Epa10, complete genome 57805-57836 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871461 UNVERIFIED: Pseudomonas phage Pa-J, complete genome 40777-40808 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MT119376 Pseudomonas phage chunk, complete genome 61300-61331 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871458 UNVERIFIED: Pseudomonas phage Pa-G, complete genome 9783-9814 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871459 UNVERIFIED: Pseudomonas phage Pa-H, complete genome 33293-33324 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871509 UNVERIFIED: Pseudomonas phage pasz5, complete genome 33579-33610 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 NC_019935 Pseudomonas phage KPP12 DNA, complete genome 60665-60696 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871465 UNVERIFIED: Pseudomonas virus Pa-N, complete genome 33297-33328 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 LZ998059 JP 2017534684-A/6: Phage Therapy 29279-29310 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 LQ277711 Sequence 6 from Patent WO2016071503 29279-29310 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 NC_042079 Pseudomonas phage vB_PaeM_E217, complete genome 61612-61643 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MT118297 Pseudomonas phage Epa20, complete genome 6514-6545 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MN871487 UNVERIFIED: Pseudomonas phage PaSz-9_45_65k, complete genome 55170-55201 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 LC472884 Pseudomonas phage S50 DNA, complete genome 7988-8019 9 0.719
NZ_CP043027_1 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT 3899246-3899277 32 MG897799 Pseudomonas phage vB_PaeM_LS1, complete genome 29597-29628 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MK837010 Pseudomonas virus Pa204, complete genome 2999-3030 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871485 UNVERIFIED: Pseudomonas phage PaSz-8_45_66k, complete genome 5286-5317 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871468 UNVERIFIED: Pseudomonas phage Pa-Q, complete genome 8244-8275 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871473 UNVERIFIED: Pseudomonas virus Pa-Z, complete genome 56927-56958 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MT413450 Pseudomonas phage Epa15, complete genome 33251-33282 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871479 UNVERIFIED: Pseudomonas phage PaSt-2_45_65k, complete genome 54791-54822 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871464 UNVERIFIED: Pseudomonas phage Pa-M, complete genome 32939-32970 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MT118290 Pseudomonas phage Epa10, complete genome 57805-57836 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871461 UNVERIFIED: Pseudomonas phage Pa-J, complete genome 40777-40808 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MT119376 Pseudomonas phage chunk, complete genome 61300-61331 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871458 UNVERIFIED: Pseudomonas phage Pa-G, complete genome 9783-9814 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871459 UNVERIFIED: Pseudomonas phage Pa-H, complete genome 33293-33324 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871509 UNVERIFIED: Pseudomonas phage pasz5, complete genome 33579-33610 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 NC_019935 Pseudomonas phage KPP12 DNA, complete genome 60665-60696 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871465 UNVERIFIED: Pseudomonas virus Pa-N, complete genome 33297-33328 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 LZ998059 JP 2017534684-A/6: Phage Therapy 29279-29310 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 LQ277711 Sequence 6 from Patent WO2016071503 29279-29310 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 NC_042079 Pseudomonas phage vB_PaeM_E217, complete genome 61612-61643 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MT118297 Pseudomonas phage Epa20, complete genome 6514-6545 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MN871487 UNVERIFIED: Pseudomonas phage PaSz-9_45_65k, complete genome 55170-55201 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 LC472884 Pseudomonas phage S50 DNA, complete genome 7988-8019 9 0.719
NZ_CP043027_1 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT 3899307-3899338 32 MG897799 Pseudomonas phage vB_PaeM_LS1, complete genome 29597-29628 9 0.719
NZ_CP043027_1 1.5|3899368|32|NZ_CP043027|CRISPRCasFinder,CRT 3899368-3899399 32 MT446420 UNVERIFIED: Escherichia virus TH54, complete genome 138081-138112 9 0.719
NZ_CP043027_1 1.9|3899612|32|NZ_CP043027|CRISPRCasFinder,CRT,PILER-CR 3899612-3899643 32 NZ_CP020540 Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence 112103-112134 9 0.719
NZ_CP043027_2 2.3|3916069|32|NZ_CP043027|CRISPRCasFinder,CRT 3916069-3916100 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 1156913-1156944 9 0.719
NZ_CP043027_2 2.4|3916130|32|NZ_CP043027|CRISPRCasFinder,CRT 3916130-3916161 32 NC_014120 Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence 477344-477375 9 0.719
NZ_CP043027_2 2.8|3916130|31|NZ_CP043027|PILER-CR 3916130-3916160 31 NC_014120 Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence 477344-477374 9 0.71
NZ_CP043027_1 1.1|3899124|32|NZ_CP043027|CRISPRCasFinder,CRT 3899124-3899155 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP043027_1 1.1|3899124|32|NZ_CP043027|CRISPRCasFinder,CRT 3899124-3899155 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP043027_1 1.5|3899368|32|NZ_CP043027|CRISPRCasFinder,CRT 3899368-3899399 32 NZ_CP024184 Moraxella osloensis strain KSH plasmid p4, complete sequence 55814-55845 10 0.688
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_002638 Salmonella enterica enterica sv Choleraesuis RF-1 plasmid pKDSC50, complete sequence 47702-47733 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_KY401053 Salmonella enterica subsp. enterica serovar Enteritidis strain SE380 plasmid unnamed, complete sequence 132184-132215 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP017620 Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence 41562-41593 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_KX807610 Salmonella enterica subsp. enterica serovar Enteritidis strain CNM4839/03 plasmid pUO-SeVR1, complete sequence 50262-50293 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 106785-106816 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_KT317612 Salmonella enterica subsp. enterica serovar Enteritidis strain EC20120002 plasmid pSE12-2, complete sequence 40861-40892 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP041027 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 plasmid pSA20143792.1, complete sequence 182158-182189 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP046282 Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence 75682-75713 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 5474-5505 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018663 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-2, complete sequence 53924-53955 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP033089 Salmonella enterica subsp. enterica serovar Enteritidis strain SEO plasmid unnamed, complete sequence 58960-58991 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP026054 Salmonella enterica strain FDAARGOS_70 plasmid unnamed2, complete sequence 58901-58932 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP023437 Salmonella enterica strain FORC_074 plasmid pFORC74_2, complete sequence 40605-40636 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP017618 Salmonella enterica subsp. enterica serovar Typhimurium strain 22495 plasmid unnamed1, complete sequence 33952-33983 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040645 Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 plasmid pCFSAN074386, complete sequence 7523-7554 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP043774 Salmonella enterica strain QH plasmid p1, complete sequence 32486-32517 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018639 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-2, complete sequence 35495-35526 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP035302 Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence 86704-86735 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP025553 Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 plasmid pPIR00558, complete sequence 527-558 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 LR794377 Salmonella Enteritidis 34134-34165 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040569 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence 53041-53072 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_007208 Salmonella enterica OU7025 plasmid pOU1113, complete sequence 77196-77227 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014980 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 plasmid pSTY1-H2662, complete sequence 35244-35275 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_HG970001 Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 plasmid pSG, complete sequence 15037-15068 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014970 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 isolate ST1126-1 plasmid pSTY1-1808, complete sequence 35248-35279 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014968 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 plasmid pSTY1-2011K-1702, complete sequence 35244-35275 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP037873 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence 29620-29651 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP037876 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence 59790-59821 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018653 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-2, complete sequence 34593-34624 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP028152 Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-1, complete sequence 31895-31926 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP033342 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_2, complete sequence 44837-44868 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 HG970000 Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 PT4 plasmid pSEN complete sequence 34631-34662 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP026570 Salmonella enterica strain MFDS1004839 plasmid pSE1004839, complete sequence 12586-12617 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 26369-26400 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032388 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence 64740-64771 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP020923 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence 78584-78615 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP017233 Salmonella enterica strain FORC_051 plasmid pFORC51, complete sequence 67686-67717 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040669 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 plasmid pSA20082869.1, complete sequence 37902-37933 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP009767 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 plasmid pFORC7, complete sequence 4685-4716 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014973 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence 35252-35283 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 KT317611 Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 plasmid pSE9-641, complete sequence 40870-40901 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 KT317613 Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 plasmid pSE12-5, complete sequence 40869-40900 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP038435 Salmonella enterica subsp. enterica serovar Typhimurium strain E40V plasmid unnamed, complete sequence 29620-29651 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014976 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 plasmid pSTY1-2009K-1640, complete sequence 35244-35275 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_017054 Salmonella enterica subsp. enterica serovar Typhimurium str. 798 plasmid p798_93, complete sequence 35150-35181 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 234215-234246 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP047324 Salmonella enterica subsp. enterica serovar Typhimurium strain RM13672 plasmid pRM13672, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014537 Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_022570 Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 unnamed plasmid, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP012397 Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence 56707-56738 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP015525 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 plasmid pSJTUF10978, complete sequence 30888-30919 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039560 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.2, complete sequence 65203-65234 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039586 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.1, complete sequence 65262-65293 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_LN999012 Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 plasmid pSLT, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP034480 Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence 76171-76202 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP038433 Salmonella enterica subsp. enterica serovar Typhimurium strain E40 plasmid unnamed, complete sequence 29620-29651 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP016390 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pSLT931, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_012124 Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 plasmid pSPCV, complete sequence 52454-52485 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP022004 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 plasmid pCFSAN051873, complete sequence 6590-6621 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP025556 Salmonella enterica subsp. enterica serovar Typhimurium strain PIR00538 plasmid pPIR00538, complete sequence 76463-76494 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP007508 Salmonella enterica subsp. enterica serovar Enteritidis strain Durban plasmid, complete sequence 56412-56443 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP008927 Salmonella enterica subsp. enterica serovar Enteritidis strain SEJ plasmid unnamed, complete sequence 40869-40900 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP041178 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367B, complete sequence 52081-52112 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP053871 Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence 59896-59927 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP053866 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence 58558-58589 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP041006 Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence 71675-71706 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018920 Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence 14999-15030 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039855 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014864 plasmid p11-0972.1, complete sequence 65274-65305 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050708 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-2, complete sequence 41711-41742 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP034231 Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence 80248-80279 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP017185 Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence 83290-83321 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP029594 Salmonella enterica strain DA34827 plasmid pDA34827-94, complete sequence 40514-40545 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP051287 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Gull_ST-29 plasmid pST29-94038, complete sequence 69940-69971 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_014476 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT1 DNA, complete sequence 51127-51158 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP017729 Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 plasmid pSARA13, complete sequence 20474-20505 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP008745 Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP015527 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 plasmid pSJTUF10984, complete sequence 30888-30919 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP011395 Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 plasmid pCFSAN000006, complete sequence 50375-50406 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP007582 Salmonella enterica subsp. enterica serovar Typhimurium strain 138736 plasmid, complete sequence 35244-35275 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 27621-27652 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP007529 Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence 39841-39872 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039566 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014849 plasmid p08-7727.1, complete sequence 65203-65234 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 91477-91508 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_013437 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSLT-BT, complete sequence 32287-32318 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_019001 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT2, complete sequence 71294-71325 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP034720 Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence 76303-76334 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_006855 Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSCV50, complete sequence 47757-47788 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP051281 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-99574.1A, complete sequence 47754-47785 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_AP014566 Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence 71113-71144 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP029596 Salmonella enterica strain DA34833 plasmid pDA34833-94, complete sequence 67347-67378 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP051277 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Sparrow_ST-87 plasmid pST87-92921, complete sequence 92942-92973 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_LS997974 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pSLT-BT 98914-98945 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 LN794247 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSBLT, complete sequence 45856-45887 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP012345 Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 plasmid pCFSAN000679_01, complete sequence 46628-46659 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP041974 Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence 93267-93298 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP041972 Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 plasmid unnamed, complete sequence 6826-6857 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP041972 Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 plasmid unnamed, complete sequence 66193-66224 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039580 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014857 plasmid p10-3881.1, complete sequence 45931-45962 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039583 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014858 plasmid p10-8609.1, complete sequence 65310-65341 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 MN125607 Salmonella enterica subsp. enterica serovar Enteritidis strain 1.1-2C7 plasmid p1.1-2C7, complete sequence 27815-27846 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 MN125608 Salmonella enterica subsp. enterica serovar Enteritidis strain 1.05-1C8 plasmid p1.05-1C8, complete sequence 27949-27980 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 MN125609 Salmonella enterica subsp. enterica serovar Enteritidis strain 1.15-2E5 plasmid p1.15-2E5, complete sequence 27949-27980 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP044969 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence 63589-63620 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP044959 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence 76177-76208 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039596 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014865 plasmid p12-4331.1, complete sequence 65203-65234 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039592 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014862 plasmid p11-0500.1, complete sequence 65320-65351 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP039568 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014850 plasmid p08-8136.1, complete sequence 65202-65233 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP011943 Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-00D989 87-1 plasmid virulence, complete sequence 34631-34662 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP014577 Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP013721 Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence 35240-35271 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 8294-8325 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_016864 Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 plasmid pSTUK-100, complete sequence 17024-17055 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP020113 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 plasmid pSTY1-1810, complete sequence 81130-81161 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014962 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 plasmid pSTY1-1899, complete sequence 35244-35275 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP053399 Salmonella enterica subsp. enterica serovar Paratyphi C strain 07-0715 plasmid unnamed, complete sequence 19958-19989 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP020824 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 plasmid pCFSAN033541, complete sequence 24523-24554 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP020826 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence 18430-18461 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP013098 Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 plasmid pCMCC50041, complete sequence 58122-58153 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032850 Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 plasmid pM0061, complete sequence 38414-38445 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050711 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-2, complete sequence 41711-41742 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_016861 Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence 35244-35275 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP021464 Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence 45883-45914 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 LN879484 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSEN-BT, strain D7795 59566-59597 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP029838 Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence 36585-36616 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018660 Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 plasmid pSE93-0639, complete sequence 44518-44549 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018641 Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605 plasmid pSE70-1605, complete sequence 34639-34670 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050725 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence 46666-46697 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014050 Salmonella enterica strain FDAARGOS_94 plasmid unnamed, complete sequence 71656-71687 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 18669-18700 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_019108 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal6919a, complete sequence 61371-61402 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_019109 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934b, complete sequence 61378-61409 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_019112 Salmonella enterica subsp. enterica serovar Pullorum plasmid pSPUV, complete sequence 83725-83756 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_019120 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSENV, complete sequence 56408-56439 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018636 Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991 plasmid pSE56-3991, complete sequence 40869-40900 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018634 Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence 21951-21982 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP038848 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014851 plasmid p09-0499.1, complete sequence 65203-65234 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP026714 Salmonella enterica strain FORC_078 plasmid pFORC_078_2, complete sequence 53094-53125 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050736 Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence 92502-92533 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040565 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence 78003-78034 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 CP054911 Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence 193650-193681 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_003277 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 plasmid pSLT, complete sequence 35245-35276 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP022071 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence 40399-40430 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP012348 Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 plasmid pCFSAN000725_01, complete sequence 19292-19323 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP051268 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence 14863-14894 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 127699-127730 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_016855 Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S plasmid unnamed, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 36762-36793 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032395 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence 104014-104045 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_LT855377 Salmonella enterica subsp. enterica serovar Typhimurium isolate STMU2UK plasmid 2 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 71630-71661 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP027413 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed2, complete sequence 71940-71971 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 70018-70049 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018650 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence 40869-40900 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014359 Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence 35243-35274 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP030796 Salmonella enterica strain 2017K-0021 plasmid p2017K-0021, complete sequence 52590-52621 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP015158 Salmonella enterica subsp. enterica serovar Typhimurium strain NC983 plasmid unnamed, complete sequence 35241-35272 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018658 Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence 85322-85353 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP028200 Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN018746 plasmid pGMI14-001, complete sequence 28283-28314 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP014357 Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence 35242-35273 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP028319 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence 87255-87286 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 112696-112727 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050722 Salmonella enterica subsp. enterica serovar Enteritidis strain SE81 plasmid pSE81-1, complete sequence 41711-41742 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050718 Salmonella enterica subsp. enterica serovar Enteritidis strain SE95 plasmid pSE95-2, complete sequence 41711-41742 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP050741 Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence 90913-90944 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP018220 Salmonella enterica subsp. enterica strain LSP 389/97 plasmid pUO-STmRV1, complete sequence 135256-135287 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040647 Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence 11342-11373 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040901 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence 29641-29672 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP040322 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence 65311-65342 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP045950 Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence 76207-76238 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 24650-24681 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 6187-6218 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP015599 Salmonella enterica strain FORC_030 plasmid pFORC_030, complete sequence 30298-30329 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP043434 Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence 41711-41742 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP025557 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p1PIR00532, complete sequence 1902-1933 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP026701 Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence 89189-89220 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 NZ_CP017178 Salmonella enterica strain FORC_056 plasmid unnamed1, complete sequence 58226-58257 11 0.656
NZ_CP043027_1 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT 3899185-3899216 32 KX777254 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTV-Mu1, complete sequence 33317-33348 11 0.656

1. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
ggcgaccagagcgtcgccaattgccagcaata	Protospacer
 ** .****  ***************** * *

2. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cgccgcc-agttcgtcgccaattgccagccaga	CRISPR spacer
-atcgtcaagctcgtcggcaattgccagccaca	Protospacer
 ..**.* **.****** ************* *

3. spacer 1.9|3899612|32|NZ_CP043027|CRISPRCasFinder,CRT,PILER-CR matches to MK524177 (Escherichia phage PHB10, complete genome) position: , mismatch: 7, identity: 0.781

cgattttgggggcaaatttgggggcaaaaatg	CRISPR spacer
taaagataggggcaaatttaggggcaaaaatg	Protospacer
..*   *.***********.************

4. spacer 2.7|3916069|31|NZ_CP043027|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774

aatctggtacgcggcaagcgccgtttcgata	CRISPR spacer
gtgctagagcgccgcaagcgccgtttcgata	Protospacer
.  **.* .*** ******************

5. spacer 2.7|3916069|31|NZ_CP043027|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774

aatctggtacgcggcaagcgccgtttcgata	CRISPR spacer
gtgctagagcgccgcaagcgccgtttcgata	Protospacer
.  **.* .*** ******************

6. spacer 2.7|3916069|31|NZ_CP043027|PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aatctggtacgcggcaagcgccgtttcgata	CRISPR spacer
taaaggacactcggcaagcgccgtttccata	Protospacer
 *   *..** **************** ***

7. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_LN997849 (Magnetospirillum sp. XM-1 isolate XM1 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.719

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
ggccgccagttcgccgccaagtgcggcgtgga	Protospacer
 ************.****** *** .  ..**

8. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MK837010 (Pseudomonas virus Pa204, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

9. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871485 (UNVERIFIED: Pseudomonas phage PaSz-8_45_66k, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

10. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871468 (UNVERIFIED: Pseudomonas phage Pa-Q, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

11. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871473 (UNVERIFIED: Pseudomonas virus Pa-Z, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

12. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT413450 (Pseudomonas phage Epa15, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

13. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871479 (UNVERIFIED: Pseudomonas phage PaSt-2_45_65k, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

14. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871464 (UNVERIFIED: Pseudomonas phage Pa-M, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

15. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT118290 (Pseudomonas phage Epa10, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

16. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871461 (UNVERIFIED: Pseudomonas phage Pa-J, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

17. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT119376 (Pseudomonas phage chunk, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

18. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871458 (UNVERIFIED: Pseudomonas phage Pa-G, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

19. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871459 (UNVERIFIED: Pseudomonas phage Pa-H, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

20. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871509 (UNVERIFIED: Pseudomonas phage pasz5, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

21. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019935 (Pseudomonas phage KPP12 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

22. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871465 (UNVERIFIED: Pseudomonas virus Pa-N, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

23. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LZ998059 (JP 2017534684-A/6: Phage Therapy) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

24. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LQ277711 (Sequence 6 from Patent WO2016071503) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

25. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_042079 (Pseudomonas phage vB_PaeM_E217, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

26. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT118297 (Pseudomonas phage Epa20, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

27. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871487 (UNVERIFIED: Pseudomonas phage PaSz-9_45_65k, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

28. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LC472884 (Pseudomonas phage S50 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

29. spacer 1.3|3899246|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MG897799 (Pseudomonas phage vB_PaeM_LS1, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

30. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MK837010 (Pseudomonas virus Pa204, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

31. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871485 (UNVERIFIED: Pseudomonas phage PaSz-8_45_66k, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

32. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871468 (UNVERIFIED: Pseudomonas phage Pa-Q, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

33. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871473 (UNVERIFIED: Pseudomonas virus Pa-Z, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

34. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT413450 (Pseudomonas phage Epa15, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

35. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871479 (UNVERIFIED: Pseudomonas phage PaSt-2_45_65k, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

36. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871464 (UNVERIFIED: Pseudomonas phage Pa-M, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

37. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT118290 (Pseudomonas phage Epa10, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

38. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871461 (UNVERIFIED: Pseudomonas phage Pa-J, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

39. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT119376 (Pseudomonas phage chunk, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

40. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871458 (UNVERIFIED: Pseudomonas phage Pa-G, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

41. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871459 (UNVERIFIED: Pseudomonas phage Pa-H, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

42. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871509 (UNVERIFIED: Pseudomonas phage pasz5, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

43. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019935 (Pseudomonas phage KPP12 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

44. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871465 (UNVERIFIED: Pseudomonas virus Pa-N, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

45. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LZ998059 (JP 2017534684-A/6: Phage Therapy) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

46. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LQ277711 (Sequence 6 from Patent WO2016071503) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

47. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_042079 (Pseudomonas phage vB_PaeM_E217, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

48. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT118297 (Pseudomonas phage Epa20, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

49. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN871487 (UNVERIFIED: Pseudomonas phage PaSz-9_45_65k, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

50. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LC472884 (Pseudomonas phage S50 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

51. spacer 1.4|3899307|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MG897799 (Pseudomonas phage vB_PaeM_LS1, complete genome) position: , mismatch: 9, identity: 0.719

cccgctatagcgattatctggctctcgtttct	CRISPR spacer
cccgctgtagcgatcatctggcttccagacgt	Protospacer
******.*******.********..*.  . *

52. spacer 1.5|3899368|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MT446420 (UNVERIFIED: Escherichia virus TH54, complete genome) position: , mismatch: 9, identity: 0.719

cacaaaaaatagcgtcggcaactgcgtgccgt	CRISPR spacer
cacaaaaactatcgtcggcaactggtcaagat	Protospacer
******** ** ************  ..  .*

53. spacer 1.9|3899612|32|NZ_CP043027|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 9, identity: 0.719

cgattttgggggcaaatttgggggcaaaaatg	CRISPR spacer
cttttttgggggcagttttgggggcattgttc	Protospacer
*  ***********. **********  . * 

54. spacer 2.3|3916069|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aatctggtacgcggcaagcgccgtttcgatac	CRISPR spacer
taaaggacactcggcaagcgccgtttccatag	Protospacer
 *   *..** **************** *** 

55. spacer 2.4|3916130|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 9, identity: 0.719

atcaggttcacctcgcgaatatcgtcgctgcc	CRISPR spacer
atcaggttcacctggcgaagatccttcagatc	Protospacer
************* ***** *** *.   ..*

56. spacer 2.8|3916130|31|NZ_CP043027|PILER-CR matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 9, identity: 0.71

atcaggttcacctcgcgaatatcgtcgctgc	CRISPR spacer
atcaggttcacctggcgaagatccttcagat	Protospacer
************* ***** *** *.   ..

57. spacer 1.1|3899124|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

58. spacer 1.1|3899124|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

59. spacer 1.5|3899368|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP024184 (Moraxella osloensis strain KSH plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688

cacaaaaaatagcgtcggcaactgcgtgccgt	CRISPR spacer
cacaaaaaatagcgttagcaacttttaaacaa	Protospacer
***************..****** .  . *. 

60. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_002638 (Salmonella enterica enterica sv Choleraesuis RF-1 plasmid pKDSC50, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

61. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_KY401053 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE380 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

62. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP017620 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

63. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_KX807610 (Salmonella enterica subsp. enterica serovar Enteritidis strain CNM4839/03 plasmid pUO-SeVR1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

64. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

65. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_KT317612 (Salmonella enterica subsp. enterica serovar Enteritidis strain EC20120002 plasmid pSE12-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

66. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP041027 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 plasmid pSA20143792.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

67. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP046282 (Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

68. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

69. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018663 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

70. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP033089 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEO plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

71. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP026054 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

72. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP023437 (Salmonella enterica strain FORC_074 plasmid pFORC74_2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

73. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP017618 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22495 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

74. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040645 (Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 plasmid pCFSAN074386, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

75. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP043774 (Salmonella enterica strain QH plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

76. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018639 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

77. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP035302 (Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

78. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP025553 (Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 plasmid pPIR00558, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

79. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LR794377 (Salmonella Enteritidis) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

80. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040569 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

81. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_007208 (Salmonella enterica OU7025 plasmid pOU1113, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

82. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014980 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 plasmid pSTY1-H2662, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

83. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_HG970001 (Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 plasmid pSG, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

84. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014970 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 isolate ST1126-1 plasmid pSTY1-1808, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

85. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014968 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 plasmid pSTY1-2011K-1702, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

86. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP037873 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

87. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP037876 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

88. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018653 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

89. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP028152 (Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

90. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP033342 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

91. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to HG970000 (Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 PT4 plasmid pSEN complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

92. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP026570 (Salmonella enterica strain MFDS1004839 plasmid pSE1004839, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

93. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

94. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032388 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

95. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP020923 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

96. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP017233 (Salmonella enterica strain FORC_051 plasmid pFORC51, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

97. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040669 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 plasmid pSA20082869.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

98. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP009767 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 plasmid pFORC7, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

99. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014973 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

100. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to KT317611 (Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 plasmid pSE9-641, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

101. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to KT317613 (Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 plasmid pSE12-5, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

102. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP038435 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40V plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

103. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014976 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 plasmid pSTY1-2009K-1640, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

104. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_017054 (Salmonella enterica subsp. enterica serovar Typhimurium str. 798 plasmid p798_93, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

105. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

106. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP047324 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM13672 plasmid pRM13672, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

107. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014537 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

108. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_022570 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 unnamed plasmid, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

109. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP012397 (Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

110. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP015525 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 plasmid pSJTUF10978, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

111. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039560 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

112. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039586 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

113. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_LN999012 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 plasmid pSLT, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

114. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP034480 (Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

115. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP038433 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

116. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP016390 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pSLT931, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

117. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_012124 (Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 plasmid pSPCV, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

118. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP022004 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 plasmid pCFSAN051873, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

119. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP025556 (Salmonella enterica subsp. enterica serovar Typhimurium strain PIR00538 plasmid pPIR00538, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

120. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP007508 (Salmonella enterica subsp. enterica serovar Enteritidis strain Durban plasmid, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

121. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP008927 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEJ plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

122. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP041178 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367B, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

123. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP053871 (Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

124. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP053866 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

125. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP041006 (Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

126. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018920 (Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

127. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039855 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014864 plasmid p11-0972.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

128. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050708 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

129. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP034231 (Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

130. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

131. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP029594 (Salmonella enterica strain DA34827 plasmid pDA34827-94, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

132. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP051287 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Gull_ST-29 plasmid pST29-94038, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

133. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_014476 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT1 DNA, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

134. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP017729 (Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 plasmid pSARA13, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

135. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP008745 (Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

136. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP015527 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 plasmid pSJTUF10984, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

137. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP011395 (Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 plasmid pCFSAN000006, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

138. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP007582 (Salmonella enterica subsp. enterica serovar Typhimurium strain 138736 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

139. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

140. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP007529 (Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

141. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039566 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014849 plasmid p08-7727.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

142. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

143. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_013437 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSLT-BT, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

144. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019001 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

145. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP034720 (Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

146. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_006855 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSCV50, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

147. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP051281 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-99574.1A, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

148. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_AP014566 (Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

149. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP029596 (Salmonella enterica strain DA34833 plasmid pDA34833-94, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

150. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP051277 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Sparrow_ST-87 plasmid pST87-92921, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

151. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_LS997974 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pSLT-BT) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

152. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LN794247 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSBLT, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

153. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP012345 (Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 plasmid pCFSAN000679_01, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

154. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP041974 (Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

155. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP041972 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

156. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP041972 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

157. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039580 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014857 plasmid p10-3881.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

158. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039583 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014858 plasmid p10-8609.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

159. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN125607 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.1-2C7 plasmid p1.1-2C7, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

160. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN125608 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.05-1C8 plasmid p1.05-1C8, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

161. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to MN125609 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.15-2E5 plasmid p1.15-2E5, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

162. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP044969 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

163. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP044959 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

164. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039596 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014865 plasmid p12-4331.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

165. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039592 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014862 plasmid p11-0500.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

166. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP039568 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014850 plasmid p08-8136.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

167. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP011943 (Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-00D989 87-1 plasmid virulence, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

168. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP014577 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

169. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP013721 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

170. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

171. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_016864 (Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 plasmid pSTUK-100, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

172. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP020113 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 plasmid pSTY1-1810, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

173. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014962 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 plasmid pSTY1-1899, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

174. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP053399 (Salmonella enterica subsp. enterica serovar Paratyphi C strain 07-0715 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

175. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP020824 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 plasmid pCFSAN033541, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

176. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP020826 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

177. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP013098 (Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 plasmid pCMCC50041, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

178. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032850 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 plasmid pM0061, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

179. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050711 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

180. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_016861 (Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

181. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP021464 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

182. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to LN879484 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSEN-BT, strain D7795) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

183. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP029838 (Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

184. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018660 (Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 plasmid pSE93-0639, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

185. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018641 (Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605 plasmid pSE70-1605, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

186. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050725 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

187. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014050 (Salmonella enterica strain FDAARGOS_94 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

188. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

189. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019108 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal6919a, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

190. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019109 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934b, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

191. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019112 (Salmonella enterica subsp. enterica serovar Pullorum plasmid pSPUV, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

192. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_019120 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSENV, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

193. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018636 (Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991 plasmid pSE56-3991, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

194. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018634 (Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

195. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP038848 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014851 plasmid p09-0499.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

196. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP026714 (Salmonella enterica strain FORC_078 plasmid pFORC_078_2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

197. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050736 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

198. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040565 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

199. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to CP054911 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

200. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_003277 (Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 plasmid pSLT, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

201. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP022071 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

202. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP012348 (Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 plasmid pCFSAN000725_01, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

203. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP051268 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

204. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

205. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_016855 (Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

206. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

207. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

208. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_LT855377 (Salmonella enterica subsp. enterica serovar Typhimurium isolate STMU2UK plasmid 2) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

209. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

210. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP027413 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

211. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

212. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018650 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

213. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014359 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

214. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP030796 (Salmonella enterica strain 2017K-0021 plasmid p2017K-0021, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

215. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP015158 (Salmonella enterica subsp. enterica serovar Typhimurium strain NC983 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

216. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018658 (Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

217. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP028200 (Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN018746 plasmid pGMI14-001, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

218. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP014357 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

219. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP028319 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

220. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

221. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050722 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE81 plasmid pSE81-1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

222. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050718 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE95 plasmid pSE95-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

223. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP050741 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

224. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP018220 (Salmonella enterica subsp. enterica strain LSP 389/97 plasmid pUO-STmRV1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

225. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040647 (Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

226. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040901 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

227. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP040322 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

228. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP045950 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

229. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

230. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

231. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP015599 (Salmonella enterica strain FORC_030 plasmid pFORC_030, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

232. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP043434 (Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

233. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP025557 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p1PIR00532, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

234. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP026701 (Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

235. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to NZ_CP017178 (Salmonella enterica strain FORC_056 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

236. spacer 1.2|3899185|32|NZ_CP043027|CRISPRCasFinder,CRT matches to KX777254 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTV-Mu1, complete sequence) position: , mismatch: 11, identity: 0.656

cgccgccagttcgtcgccaattgccagccaga	CRISPR spacer
tatggccagatcgtcggcaattgccagttttg	Protospacer
... ***** ****** **********..  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 457751 : 508339 49 Burkholderia_phage(33.33%) tail,tRNA,plate NA
DBSCAN-SWA_2 751830 : 807770 52 uncultured_Caudovirales_phage(16.67%) integrase,transposase,protease,tRNA attL 775810:775824|attR 812295:812309
DBSCAN-SWA_3 1882301 : 1889612 7 Dickeya_phage(16.67%) integrase,protease attL 1883552:1883566|attR 1895066:1895080
DBSCAN-SWA_4 1940291 : 2041975 99 Salmonella_phage(37.29%) integrase,tail,terminase,lysis,transposase,tRNA,protease,holin,portal attL 1935735:1935751|attR 2016497:2016513
DBSCAN-SWA_5 2759906 : 2813098 54 Enterobacteria_phage(25.0%) tail,integrase,protease,tRNA attL 2754461:2754475|attR 2815771:2815785
DBSCAN-SWA_6 2920385 : 2972185 66 Salmonella_phage(75.0%) tail,integrase,terminase,lysis,head,capsid,holin,plate attL 2917010:2917024|attR 2976933:2976947
DBSCAN-SWA_7 3058386 : 3068893 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_8 3146608 : 3155779 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_9 3617805 : 3661148 58 Salmonella_phage(75.47%) tail,integrase,holin attL 3636366:3636379|attR 3666922:3666935
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage