Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042581 Enterobacter kobei strain C16 plasmid pC16_003, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 0 crisprs csa3 0 0 2 0
NZ_CP042580 Enterobacter kobei strain C16 plasmid pC16_002, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP042578 Enterobacter kobei strain C16 chromosome, complete genome 5 crisprs DEDDh,csa3,WYL,DinG,cas1,cas3f,cas8f,cas5f,cas7f,cas6f,cas3,RT 2 14 9 3

Results visualization

1. NZ_CP042579
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 72031 : 123894 55 Enterobacteria_phage(20.0%) transposase,protease NA
DBSCAN-SWA_2 135288 : 238562 113 Escherichia_phage(33.33%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP042580
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2110 : 44059 57 Escherichia_phage(25.0%) integrase,protease,transposase attL 10460:10474|attR 48950:48964

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP042578
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042578_1 1077802-1077947 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042578_2 1515000-1515267 TypeI-F I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042578_3 1530300-1530809 TypeI-F I-F
8 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042578_4 1538771-1539578 TypeI-F I-F
13 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042578_5 2018281-2018429 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 NZ_CP042578.1 2823823-2823854 1 0.969
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 NZ_CP042578.1 3531115-3531146 1 0.969
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 NZ_CP042578.1 2831554-2831585 2 0.938
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 NZ_CP042578.1 3537423-3537454 2 0.938

1. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to position: 2823823-2823854, mismatch: 1, identity: 0.969 

ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
ttaaatgcgcagaagtcaccggagttgttcag	Protospacer
*********************.**********

2. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to position: 3531115-3531146, mismatch: 1, identity: 0.969 

ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
ttaaatgcgcagaagtcaccggagttgttcag	Protospacer
*********************.**********

3. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to position: 2831554-2831585, mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

4. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to position: 3537423-3537454, mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 NC_016158 Escherichia phage HK639, complete genome 42284-42315 1 0.969
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 MN856003 Bacteriophage sp. isolate 1, complete genome 29138-29169 1 0.969
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 M11919 Bacteriophage phi-80 cI immunity region encoding the N gene 640-671 2 0.938
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 MN856003 Bacteriophage sp. isolate 1, complete genome 37224-37255 2 0.938
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 NC_021190 Enterobacteria phage phi80, complete genome 33169-33200 2 0.938
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 NC_019717 Enterobacteria phage HK225, complete genome 31517-31548 2 0.938
NZ_CP042578_3 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT 1530750-1530781 32 X13065 Bacteriophage phi80 early region 1107-1138 2 0.938
NZ_CP042578_1 1.1|1077855|40|NZ_CP042578|CRISPRCasFinder 1077855-1077894 40 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 167180-167219 4 0.9
NZ_CP042578_1 1.1|1077855|40|NZ_CP042578|CRISPRCasFinder 1077855-1077894 40 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 9765-9804 4 0.9
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 46889-46920 4 0.875
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 X92588 Bacteriophage 82 orf33, orf151, orf56, orf96, rus, orf45, and Q genes 93-124 4 0.875
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 43041-43072 4 0.875
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 43324-43355 4 0.875
NZ_CP042578_2 2.1|1515028|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515028-1515059 32 MH518298 Pseudomonas phage SCYZ1, complete genome 46426-46457 7 0.781
NZ_CP042578_2 2.2|1515088|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515088-1515119 32 MK388859 Klebsiella phage ST405-OXA48phi1.1, complete genome 26866-26897 7 0.781
NZ_CP042578_3 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1530630-1530661 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 165109-165140 7 0.781
NZ_CP042578_4 4.2|1538859|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1538859-1538890 32 NZ_CP018612 Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD01, complete sequence 11036-11067 7 0.781
NZ_CP042578_4 4.2|1538859|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1538859-1538890 32 NZ_CP018613 Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD02, complete sequence 10381-10412 7 0.781
NZ_CP042578_3 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1530630-1530661 32 MT310894 Microbacterium phage Tempo, complete genome 41003-41034 8 0.75
NZ_CP042578_4 4.3|1538919|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1538919-1538950 32 NZ_CP022193 Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence 70460-70491 8 0.75
NZ_CP042578_1 1.1|1077855|40|NZ_CP042578|CRISPRCasFinder 1077855-1077894 40 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 422250-422289 9 0.775
NZ_CP042578_2 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515148-1515179 32 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 552432-552463 9 0.719
NZ_CP042578_2 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515148-1515179 32 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 451997-452028 9 0.719
NZ_CP042578_2 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515148-1515179 32 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 330549-330580 9 0.719
NZ_CP042578_2 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515148-1515179 32 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 330310-330341 9 0.719
NZ_CP042578_2 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1515148-1515179 32 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 330394-330425 9 0.719
NZ_CP042578_3 3.1|1530328|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1530328-1530359 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 259220-259251 9 0.719
NZ_CP042578_3 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1530630-1530661 32 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 198017-198048 9 0.719
NZ_CP042578_3 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1530630-1530661 32 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 207573-207604 9 0.719
NZ_CP042578_3 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1530630-1530661 32 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 489781-489812 9 0.719
NZ_CP042578_4 4.1|1538799|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1538799-1538830 32 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 90257-90288 9 0.719
NZ_CP042578_4 4.3|1538919|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1538919-1538950 32 MH019216 Streptomyces phage Wentworth, complete genome 31307-31338 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 MN693267 Marine virus AFVG_25M289, complete genome 35573-35604 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 MN693101 Marine virus AFVG_25M559, complete genome 19033-19064 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 NC_042044 Salmonella phage Melville, complete genome 29919-29950 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 NZ_CP038171 Enterococcus faecium strain SDGJP3 plasmid pSDGJP3, complete sequence 47970-48001 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 NZ_CP038176 Enterococcus faecium strain HN11 plasmid pHN11, complete sequence 24221-24252 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 NZ_MH784601 Enterococcus faecium strain 25 plasmid pC25-1, complete sequence 6885-6916 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 NZ_MH784602 Enterococcus faecium strain 27 plasmid pC27-2, complete sequence 6885-6916 9 0.719
NZ_CP042578_4 4.11|1539399|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539399-1539430 32 NZ_CP026333 Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence 208432-208463 9 0.719
NZ_CP042578_4 4.12|1539459|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539459-1539490 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2590628-2590659 9 0.719
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 MN698247 Pelagibacter phage HTVC115P, complete genome 32036-32067 10 0.688
NZ_CP042578_4 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT 1539519-1539550 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 441459-441490 10 0.688
NZ_CP042578_4 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT 1539279-1539310 32 AP013455 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C40 4502-4533 11 0.656

1. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to NC_016158 (Escherichia phage HK639, complete genome) position: , mismatch: 1, identity: 0.969 

ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
ttaaatgcgcagaagtcaccggagttgttcag	Protospacer
*********************.**********

2. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 1, identity: 0.969 

ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
ttaaatgcgcagaagtcaccggagttgttcag	Protospacer
*********************.**********

3. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to M11919 (Bacteriophage phi-80 cI immunity region encoding the N gene) position: , mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

4. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

5. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to NC_021190 (Enterobacteria phage phi80, complete genome) position: , mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

6. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to NC_019717 (Enterobacteria phage HK225, complete genome) position: , mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

7. spacer 3.8|1530750|32|NZ_CP042578|CRISPRCasFinder,CRT matches to X13065 (Bacteriophage phi80 early region) position: , mismatch: 2, identity: 0.938 

atcgaaaggaaacatcgacaactgagcgaagt	CRISPR spacer
atcgaaacgaaacatcgacagctgagcgaagt	Protospacer
******* ************.***********

8. spacer 1.1|1077855|40|NZ_CP042578|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 4, identity: 0.9 

tccgtgggagagggccagggtgagggcatcagaccgcaca	CRISPR spacer
cccgtgggagagggtcggggtgagggcatcagaccgcacc	Protospacer
.*************.*.**********************

9. spacer 1.1|1077855|40|NZ_CP042578|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 4, identity: 0.9 

tccgtgggagagggccagggtgagggcatcagaccgcaca	CRISPR spacer
cctgtgggagagggccggggtgagggcatcagaccgcacg	Protospacer
.*.*************.**********************.

10. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 4, identity: 0.875 

---ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
cgttta---gcgcagaagtcaccggagttgttcag	Protospacer
   ***   ***************.**********

11. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to X92588 (Bacteriophage 82 orf33, orf151, orf56, orf96, rus, orf45, and Q genes) position: , mismatch: 4, identity: 0.875 

---ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
cgttta---gcgcagaagtcaccggagttgttcag	Protospacer
   ***   ***************.**********

12. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 4, identity: 0.875 

---ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
cgttta---gcgcagaagtcaccggagttgttcag	Protospacer
   ***   ***************.**********

13. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 4, identity: 0.875 

---ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
cgttta---gcgcagaagtcaccggagttgttcag	Protospacer
   ***   ***************.**********

14. spacer 2.1|1515028|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 7, identity: 0.781 

cactcgcgagaatgagcaaggcggcagtctat	CRISPR spacer
caatgacgagaatgagaaaggcggcattcgct	Protospacer
** * .********** ********* **  *

15. spacer 2.2|1515088|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MK388859 (Klebsiella phage ST405-OXA48phi1.1, complete genome) position: , mismatch: 7, identity: 0.781 

gaaccacggatggataagctcgcccgggccgg	CRISPR spacer
aaacacaggatgaataagctcgcccgagccgc	Protospacer
.***   *****.*************.****

16. spacer 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

agaactcgtcccagatgtactggcagagctgg--	CRISPR spacer
tgacctcgtcccagatggactggc--cgctgacg	Protospacer
 ** ************* ******   ****.

17. spacer 4.2|1538859|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018612 (Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD01, complete sequence) position: , mismatch: 7, identity: 0.781 

gtccagatggcttaaaaccagtc---gttttctgg	CRISPR spacer
gtccagatggcttaaaagcactcgaaggtgtc---	Protospacer
***************** ** **   * * **

18. spacer 4.2|1538859|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018613 (Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD02, complete sequence) position: , mismatch: 7, identity: 0.781 

gtccagatggcttaaaaccagtc---gttttctgg	CRISPR spacer
gtccagatggcttaaaagcactcgaaggtgtc---	Protospacer
***************** ** **   * * **

19. spacer 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 8, identity: 0.75 

agaactcgtcccagatgtactggcagagctgg	CRISPR spacer
agaactcggccaagatgtactggcgcgtcggc	Protospacer
******** ** ************. . * *

20. spacer 4.3|1538919|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

aacgcagctctgcgcgctcaagtccatcgcgg	CRISPR spacer
caccttgctctgcgcgctcaaatccagcgggc	Protospacer
 ** . ***************.**** ** *

21. spacer 1.1|1077855|40|NZ_CP042578|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.775 

tccgtgggagagggccagggtgagggcatcagaccgcaca	CRISPR spacer
cctgtgggagagggccggggtgagggcatcaggcattagc	Protospacer
.*.*************.***************.*  .*

22. spacer 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggaatactttcaggattcgagccggggatcct	CRISPR spacer
tgcggtcattcaggcttcgatccggggatccc	Protospacer
 * .  * ****** ***** **********.

23. spacer 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 9, identity: 0.719 

ggaatactttcaggattcgagccggggatcct	CRISPR spacer
tgcggtcattcaggcttcgatccggggatccc	Protospacer
 * .  * ****** ***** **********.

24. spacer 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 9, identity: 0.719 

ggaatactttcaggattcgagccggggatcct	CRISPR spacer
tgcggtcattcaggcttcgatccggggatccc	Protospacer
 * .  * ****** ***** **********.

25. spacer 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 9, identity: 0.719 

ggaatactttcaggattcgagccggggatcct	CRISPR spacer
tgcggtcattcaggcttcgatccggggatccc	Protospacer
 * .  * ****** ***** **********.

26. spacer 2.3|1515148|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 9, identity: 0.719 

ggaatactttcaggattcgagccggggatcct	CRISPR spacer
tgcggtcattcaggcttcgatccggggatccc	Protospacer
 * .  * ****** ***** **********.

27. spacer 3.1|1530328|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

ctatatgctgcgccgcctccgctacgctcaaa	CRISPR spacer
tcgtctgctgcgccgccgccgccacgctggag	Protospacer
...* ************ ****.***** .*.

28. spacer 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719 

agaactcgtcccagatgtactggcagagctgg	CRISPR spacer
agcgacaccccccgatgtactggctgagctgg	Protospacer
** . .  .*** *********** *******

29. spacer 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719 

agaactcgtcccagatgtactggcagagctgg	CRISPR spacer
agcgacaccccccgatgtactggctgagctgg	Protospacer
** . .  .*** *********** *******

30. spacer 3.6|1530630|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719 

agaactcgtcccagatgtactggcagagctgg	CRISPR spacer
agcgacaccccccgatgtactggctgagctgg	Protospacer
** . .  .*** *********** *******

31. spacer 4.1|1538799|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

acaatgtttgccaatacaaacaaagtcggcca	CRISPR spacer
ctcattaaagccaataccaaaaaagtcggcca	Protospacer
 . **    ******** ** ***********

32. spacer 4.3|1538919|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 9, identity: 0.719 

aacgcagctctgcgcgctcaagtccatcgcgg	CRISPR spacer
acacttggcctgcgagctcaaggccatcgcgg	Protospacer
*   . * .***** ******* *********

33. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MN693267 (Marine virus AFVG_25M289, complete genome) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
caaagcattagctgacatagataaattaaagg	Protospacer
* ..  *********.*********** **

34. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
caaagcattagctgacatagataaattaaaag	Protospacer
* ..  *********.*********** **

35. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NC_042044 (Salmonella phage Melville, complete genome) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
ttctacattagctgaaatagataaattgaata	Protospacer
.*    ********* *********** **.

36. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038171 (Enterococcus faecium strain SDGJP3 plasmid pSDGJP3, complete sequence) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
ttttcgattagctgatttaaataaattacata	Protospacer
.*  ************ **.*******  *.

37. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038176 (Enterococcus faecium strain HN11 plasmid pHN11, complete sequence) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
ttttcgattagctgatttaaataaattacata	Protospacer
.*  ************ **.*******  *.

38. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH784601 (Enterococcus faecium strain 25 plasmid pC25-1, complete sequence) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
ttttcgattagctgatttaaataaattacata	Protospacer
.*  ************ **.*******  *.

39. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH784602 (Enterococcus faecium strain 27 plasmid pC27-2, complete sequence) position: , mismatch: 9, identity: 0.719 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
ttttcgattagctgatttaaataaattacata	Protospacer
.*  ************ **.*******  *.

40. spacer 4.11|1539399|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 9, identity: 0.719 

gccgccgcaccgatattacgaacagcatggaa	CRISPR spacer
tcacacgcaccgatattacggacagtatccga	Protospacer
 *   ***************.****.**  .*

41. spacer 4.12|1539459|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

atcatcccgggtcagctcgtcaccagccggta	CRISPR spacer
ctcgtcccgggtcagcgcgtcaccgaccacct	Protospacer
 **.************ *******..**. .

42. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to MN698247 (Pelagibacter phage HTVC115P, complete genome) position: , mismatch: 10, identity: 0.688 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
taaagcattagctgatatagaaaaattgaaag	Protospacer
. ..  *************** ***** **

43. spacer 4.13|1539519|32|NZ_CP042578|CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 10, identity: 0.688 

ttaaatgcgcagaagtcaccgaagttgttcag	CRISPR spacer
caccatgcgcagaagtcagcgtagttggatcg	Protospacer
.   ************** ** *****  . *

44. spacer 4.9|1539279|32|NZ_CP042578|PILER-CR,CRISPRCasFinder,CRT matches to AP013455 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C40) position: , mismatch: 11, identity: 0.656 

ctggcgattagctgatatagataaattcaact	CRISPR spacer
taaagctttagctgatatagaaaaattaaaag	Protospacer
. ..   ************** ***** **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1524122 : 1534160 7 Vibrio_phage(33.33%) protease NA
DBSCAN-SWA_2 1582412 : 1674562 96 Enterobacteria_phage(30.19%) capsid,protease,tRNA,tail,terminase,portal,holin,head NA
DBSCAN-SWA_3 2453602 : 2475084 20 Enterobacteria_phage(50.0%) transposase,integrase,tail attL 2447022:2447036|attR 2459804:2459818
DBSCAN-SWA_4 2480925 : 2487854 9 Escherichia_phage(50.0%) integrase,tRNA attL 2470420:2470433|attR 2496825:2496838
DBSCAN-SWA_5 2554051 : 2613788 72 Erwinia_phage(27.5%) capsid,integrase,protease,lysis,tail,plate,head,terminase,holin,portal attL 2597298:2597316|attR 2616114:2616132
DBSCAN-SWA_6 2779862 : 2842579 86 Cronobacter_phage(25.81%) integrase,protease,coat,tail,terminase,head,holin attL 2792118:2792147|attR 2840368:2840397
DBSCAN-SWA_7 3033004 : 3040432 7 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_8 3508560 : 3687501 224 Salmonella_phage(27.21%) capsid,integrase,lysis,tRNA,tail,plate,terminase,portal,head,holin,transposase attL 3610537:3610552|attR 3688415:3688430
DBSCAN-SWA_9 4139095 : 4180028 30 Stx2-converting_phage(18.18%) transposase,integrase attL 4160500:4160515|attR 4187289:4187304

Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP042578.1|WP_038421068.1|3588747_3589119_+|hypothetical-protein 3588747_3589119_+ 123 aa aa NA NA NA 3508560-3687501 yes
NZ_CP042578.1|WP_151571648.1|3610347_3610530_+|hypothetical-protein 3610347_3610530_+ 60 aa aa NA NA NA 3508560-3687501 yes
NZ_CP042578.1|WP_047028403.1|3677504_3677822_-|hypothetical-protein 3677504_3677822_- 105 aa aa NA NA NA 3508560-3687501 yes