Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042843 Escherichia coli strain JME67 chromosome, complete genome 5 crisprs DEDDh,WYL,DinG,cas3,c2c9_V-U4,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 11 346 0

Results visualization

1. NZ_CP042843
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042843_1 1117139-1117283 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042843_2 1257429-1257525 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042843_3 3055912-3056038 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042843_4 3586292-3587054 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042843_5 3612605-3612998 Unclear I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042843_5 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612877-3612909 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
NZ_CP042843_5 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612877-3612909 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
NZ_CP042843_5 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612877-3612909 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
NZ_CP042843_4 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586565-3586596 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
NZ_CP042843_4 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586565-3586596 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
NZ_CP042843_4 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586933-3586964 32 KY883647 Vibrio phage JSF33, complete genome 9760-9791 6 0.812
NZ_CP042843_4 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586994-3587025 32 NZ_CP009293 Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence 152196-152227 6 0.812
NZ_CP042843_5 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612877-3612909 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
NZ_CP042843_4 4.1|3586321|32|NZ_CP042843|CRISPRCasFinder,CRT 3586321-3586352 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
NZ_CP042843_4 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586565-3586596 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
NZ_CP042843_4 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586565-3586596 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 375744-375776 8 0.758
NZ_CP042843_4 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586933-3586964 32 MN855762 Bacteriophage sp. isolate 505, complete genome 4840-4871 8 0.75
NZ_CP042843_4 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586933-3586964 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 224460-224491 8 0.75
NZ_CP042843_4 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586994-3587025 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 750410-750441 8 0.75
NZ_CP042843_5 5.4|3612816|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612816-3612848 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 26182-26214 9 0.727
NZ_CP042843_4 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586933-3586964 32 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 104261-104292 9 0.719
NZ_CP042843_4 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586933-3586964 32 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 142898-142929 9 0.719
NZ_CP042843_4 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586994-3587025 32 MN234174 Mycobacterium phage Efra2, complete genome 35614-35645 9 0.719
NZ_CP042843_4 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586994-3587025 32 MN234165 Mycobacterium phage Yunkel11, complete genome 35570-35601 9 0.719
NZ_CP042843_4 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586994-3587025 32 MN234201 Mycobacterium phage Guanica15, complete genome 35571-35602 9 0.719
NZ_CP042843_1 1.1|1117182|59|NZ_CP042843|CRISPRCasFinder 1117182-1117240 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
NZ_CP042843_4 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586565-3586596 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 156123-156154 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 21888-21919 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 28766-28797 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 JX469826 Uncultured bacterium plasmid pB12, complete sequence 11283-11314 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 11289-11320 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 11287-11318 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 11272-11303 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 67078-67109 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 4235-4266 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 11288-11319 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 11288-11319 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 11288-11319 10 0.688
NZ_CP042843_4 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586626-3586657 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 11350-11381 10 0.688
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 CP046443 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence 31933-31965 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 103013-103045 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 110510-110542 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_CP034079 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence 48454-48486 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_CP034080 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence 39480-39512 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 31117-31149 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 30966-30998 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_CP026560 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence 19118-19150 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_LT963406 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence 54820-54852 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 LT985193 Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2 32077-32109 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_LT963393 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence 50597-50629 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_LT985210 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence 105842-105874 10 0.697
NZ_CP042843_4 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586748-3586780 33 NZ_LT985211 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence 84272-84304 10 0.697
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052797 Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence 45808-45839 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 282589-282620 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 94965-94996 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 304288-304319 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 112376-112407 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 315682-315713 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 203378-203409 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 127648-127679 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 215302-215333 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 214483-214514 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP028316 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence 108893-108924 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 83669-83700 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 194119-194150 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 18410-18441 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP022063 Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence 64615-64646 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 169480-169511 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 6457-6488 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 25758-25789 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 140403-140434 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 160727-160758 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP031362 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence 140152-140183 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052830 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence 193709-193740 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 126974-127005 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 110984-111015 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 94916-94947 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052824 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence 91497-91528 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052822 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence 110984-111015 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 94916-94947 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052820 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence 94916-94947 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 94916-94947 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 94916-94947 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052816 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598 165317-165348 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 99109-99140 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP022662 Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence 54379-54410 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052812 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence 1671-1702 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052810 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence 212751-212782 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052808 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence 306376-306407 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 164579-164610 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052791 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence 168074-168105 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 190524-190555 10 0.688
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 CP052799 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence 6457-6488 10 0.688
NZ_CP042843_1 1.1|1117182|59|NZ_CP042843|CRISPRCasFinder 1117182-1117240 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
NZ_CP042843_4 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR 3586872-3586903 32 NZ_CP026128 Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence 49165-49196 11 0.656
NZ_CP042843_5 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612877-3612909 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP042843_5 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT 3612877-3612909 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
NZ_CP042843_3 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder 3055951-3055999 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

2. spacer 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

3. spacer 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

4. spacer 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
tgggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
************ ******** ** * ***.* 

5. spacer 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
ggggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
 *********** ******** ** * ***.* 

6. spacer 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to KY883647 (Vibrio phage JSF33, complete genome) position: , mismatch: 6, identity: 0.812

agcgtgttcggcatcacctttggcttcggctg	CRISPR spacer
agcagtttcggcatcagctttggctttggctt	Protospacer
***.  ********** *********.**** 

7. spacer 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 6, identity: 0.812

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
agaatgagcgtgtcgccgcgcgtctgcgtgag	Protospacer
 * .*******.**************** .**

8. spacer 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtcagcgttaacgccgcacaacct	Protospacer
*********** ********.****** *  * 

9. spacer 4.1|3586321|32|NZ_CP042843|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

cagcgtcaggcgtgaaatctcaccgtcgttgc	CRISPR spacer
attctttaggcgtgacatcttaccgtcgttga	Protospacer
   * *.******** ****.********** 

10. spacer 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ggggcagcttgccttgcagccagccgatgctc	Protospacer
 ****.******************.   **  

11. spacer 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
tgggccgcttgccgtgcagccagcgcttccgc	Protospacer
***** ******* ********** *.  *. 

12. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.758

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
cgcgtcggcgacgcgcaggtaatgcgcgatcag	Protospacer
   * **************  *********. *

13. spacer 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to MN855762 (Bacteriophage sp. isolate 505, complete genome) position: , mismatch: 8, identity: 0.75

agcgtgttcggcatcacctttggcttcggctg	CRISPR spacer
gaccagctcgaaatcacctttggcttcggctt	Protospacer
..*  *.***. ******************* 

14. spacer 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.75

agcgtgtt---cggcatcacctttggcttcggctg	CRISPR spacer
---ctgctcgccggcatcaccttcggcttctgcta	Protospacer
    **.*   ************.****** ***.

15. spacer 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgtgagcgtatcgccgcgcgtctgcgaaag-	CRISPR spacer
agcgagagcgtatcgccgcgc-ttcgtgaagcc	Protospacer
 *** **************** *..*.***.  

16. spacer 5.4|3612816|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

tggctctgcaacagcagcacccatgaccacgtc	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgga	Protospacer
.* ..* ****************.*******  

17. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

18. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

19. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

20. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

21. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

22. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

23. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

24. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

25. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

26. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

27. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

28. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

29. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 9, identity: 0.727

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
cgaggcggcgacacgcaaggtatgcgggtcgag	Protospacer
  **********.****.******** * .  *

30. spacer 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

agcgtgttcggcatcacctttggcttcggctg	CRISPR spacer
atccgcacgggcatcacctttggctccagctg	Protospacer
* *    . ****************.*.****

31. spacer 4.11|3586933|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

agcgtgttcggcatcacctttggcttcggctg	CRISPR spacer
ctcggcctcggcaacacctttgccttcggcgc	Protospacer
  **  .****** ******** *******  

32. spacer 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to MN234174 (Mycobacterium phage Efra2, complete genome) position: , mismatch: 9, identity: 0.719

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
gccgtgagcgtgacgccgcgcgtctggtgatc	Protospacer
  *********. *************  .*  

33. spacer 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to MN234165 (Mycobacterium phage Yunkel11, complete genome) position: , mismatch: 9, identity: 0.719

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
gccgtgagcgtgacgccgcgcgtctggtgatc	Protospacer
  *********. *************  .*  

34. spacer 4.12|3586994|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to MN234201 (Mycobacterium phage Guanica15, complete genome) position: , mismatch: 9, identity: 0.719

tgcgtgagcgtatcgccgcgcgtctgcgaaag	CRISPR spacer
gccgtgagcgtgacgccgcgcgtctggtgatc	Protospacer
  *********. *************  .*  

35. spacer 1.1|1117182|59|NZ_CP042843|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

36. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

37. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

38. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

39. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

40. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

41. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

42. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

43. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

44. spacer 4.5|3586565|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ccagcggcttgcgtggcagccagctctcaggg	Protospacer
. .********* * ***********. . .*

45. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
gcgtgtgctggcaatcgcttccggggtgacgt	Protospacer
. *.  ********** ***.********  .

46. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

47. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

48. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

49. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

50. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

51. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

52. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

53. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

54. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

55. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

56. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

57. spacer 4.6|3586626|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

58. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP046443 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

59. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

60. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

61. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034079 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

62. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034080 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

63. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

64. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

65. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026560 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

66. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963406 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

67. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to LT985193 (Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

68. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963393 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

69. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985210 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

70. spacer 4.8|3586748|33|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985211 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

71. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052797 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

72. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

73. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

74. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

75. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

76. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

77. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

78. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

79. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

80. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

81. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028316 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

82. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

83. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

84. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

85. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022063 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

86. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

87. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

88. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

89. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

90. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

91. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031362 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

92. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052830 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

93. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

94. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

95. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

96. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052824 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

97. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052822 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

98. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

99. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052820 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

100. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

101. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

102. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052816 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

103. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

104. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022662 (Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

105. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052812 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

106. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052810 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

107. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052808 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

108. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

109. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052791 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

110. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

111. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to CP052799 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence) position: , mismatch: 10, identity: 0.688

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gaggcgctatcaaacacaaccgacagggagta	Protospacer
  ..*..****** .***************. 

112. spacer 1.1|1117182|59|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

113. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

114. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

115. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

116. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

117. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

118. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

119. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

120. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

121. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

122. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

123. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

124. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

125. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

126. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

127. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

128. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

129. spacer 4.10|3586872|32|NZ_CP042843|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026128 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence) position: , mismatch: 11, identity: 0.656

tcaacattatcaattacaaccgacagggagcc	CRISPR spacer
gatacattgccaattacaaccgacagttcaaa	Protospacer
   *****..****************   .  

130. spacer 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

131. spacer 5.5|3612877|33|NZ_CP042843|PILER-CR,CRISPRCasFinder,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

132. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

133. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

134. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

135. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

136. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

137. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

138. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

139. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

140. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

141. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

142. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

143. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

144. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

145. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

146. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

147. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

148. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

149. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

150. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

151. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

152. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

153. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

154. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

155. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

156. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

157. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

158. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

159. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

160. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

161. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

162. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

163. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

164. spacer 3.1|3055951|49|NZ_CP042843|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4785 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 28293 : 33707 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 37749 : 43893 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_4 51968 : 53624 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_5 63903 : 67762 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 73480 : 75310 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_7 87842 : 91129 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_8 100108 : 100723 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 114582 : 117369 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_10 121485 : 123956 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_11 140291 : 143071 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_12 150388 : 153439 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_13 164994 : 169855 5 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_14 181429 : 185932 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_15 203230 : 210477 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_16 227823 : 229668 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_17 238260 : 241313 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_18 245429 : 253758 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_19 262974 : 264738 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_20 270127 : 271717 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_21 288012 : 291696 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_22 301954 : 303490 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 315849 : 316965 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_24 326180 : 326789 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_25 333379 : 335927 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_26 340114 : 343727 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_27 347544 : 348894 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_28 354478 : 356437 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_29 366173 : 368321 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_30 373566 : 379935 5 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_31 386169 : 387719 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_32 393331 : 394120 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_33 399456 : 400959 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_34 422154 : 425366 2 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_35 439642 : 441626 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_36 446143 : 446677 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_37 451597 : 452575 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_38 460558 : 461104 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_39 465019 : 478050 11 Vibrio_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_40 481982 : 483146 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_41 518076 : 524564 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_42 528854 : 531615 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_43 536579 : 541350 4 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_44 549936 : 559018 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_45 564144 : 568454 2 Acanthamoeba_polyphaga_mimivirus(50.0%) transposase NA
DBSCAN-SWA_46 576420 : 581369 4 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_47 605568 : 606549 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_48 609911 : 611588 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_49 621855 : 623316 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_50 629884 : 630439 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_51 660611 : 665967 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_52 669192 : 670472 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_53 678368 : 681244 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_54 687183 : 688506 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_55 696269 : 701625 3 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_56 704961 : 707075 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_57 718844 : 729262 10 Cyanophage(20.0%) transposase NA
DBSCAN-SWA_58 732997 : 735814 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_59 740257 : 741406 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_60 746877 : 752538 4 Hepacivirus(50.0%) NA NA
DBSCAN-SWA_61 760429 : 761829 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_62 770964 : 780021 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_63 792723 : 794448 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_64 820537 : 821581 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_65 825826 : 826378 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_66 835005 : 836430 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_67 844176 : 850799 5 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_68 854061 : 854964 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_69 864822 : 871628 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_70 876871 : 877669 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_71 883703 : 884048 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_72 887977 : 889402 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_73 901999 : 902758 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_74 911586 : 915702 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_75 928707 : 929739 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_76 936260 : 943892 9 Indivirus(25.0%) NA NA
DBSCAN-SWA_77 950636 : 1007252 58 Streptococcus_phage(15.38%) transposase,integrase attL 969216:969275|attR 1003524:1003583
DBSCAN-SWA_78 1021608 : 1026319 4 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_79 1031894 : 1037814 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_80 1049201 : 1050251 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_81 1059023 : 1060910 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_82 1064108 : 1065008 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_83 1071267 : 1072350 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_84 1076661 : 1080944 4 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_85 1084524 : 1088641 5 Prochlorococcus_phage(50.0%) transposase NA
DBSCAN-SWA_86 1092269 : 1093037 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_87 1097801 : 1102350 3 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_88 1109765 : 1110881 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_89 1115170 : 1125247 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_90 1132199 : 1141180 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_91 1162739 : 1167786 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_92 1170914 : 1171610 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_93 1174933 : 1178480 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_94 1187316 : 1190466 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_95 1197474 : 1206036 8 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_96 1214280 : 1217442 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_97 1221981 : 1288160 69 Enterobacteria_phage(48.28%) lysis,tRNA,terminase,integrase,transposase,protease attL 1270818:1270864|attR 1295611:1295657
DBSCAN-SWA_98 1302881 : 1304997 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_99 1308267 : 1311411 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_100 1323710 : 1329753 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_101 1344300 : 1346123 2 uncultured_marine_virus(50.0%) NA NA
DBSCAN-SWA_102 1349306 : 1351421 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_103 1366845 : 1367492 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_104 1372305 : 1374744 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_105 1381754 : 1384337 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_106 1391276 : 1398567 7 Bathycoccus_sp._RCC1105_virus(33.33%) transposase NA
DBSCAN-SWA_107 1401891 : 1402971 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_108 1407066 : 1408731 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_109 1413497 : 1417311 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_110 1430609 : 1443330 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_111 1449060 : 1452110 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_112 1455488 : 1456280 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_113 1492719 : 1496239 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_114 1500592 : 1507166 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_115 1517521 : 1518811 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_116 1525292 : 1526201 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_117 1536798 : 1551610 13 Anomala_cuprea_entomopoxvirus(14.29%) NA NA
DBSCAN-SWA_118 1555294 : 1560519 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_119 1565516 : 1573858 6 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_120 1577073 : 1578945 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_121 1590280 : 1591483 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_122 1600049 : 1609199 11 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_123 1612559 : 1615297 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_124 1618884 : 1620603 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_125 1629900 : 1653585 16 uncultured_Mediterranean_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_126 1659893 : 1660634 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_127 1669647 : 1670736 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_128 1675822 : 1680364 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_129 1695069 : 1706039 8 Rhodobacter_phage(20.0%) tRNA NA
DBSCAN-SWA_130 1720651 : 1722559 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_131 1735158 : 1737213 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_132 1741446 : 1742106 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_133 1762148 : 1774463 13 Morganella_phage(20.0%) NA NA
DBSCAN-SWA_134 1778768 : 1781042 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_135 1795679 : 1796744 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_136 1803563 : 1806125 2 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_137 1811538 : 1812372 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_138 1816507 : 1817041 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_139 1826349 : 1827270 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_140 1831929 : 1832175 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_141 1848058 : 1849000 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_142 1861357 : 1862539 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_143 1865811 : 1867454 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_144 1879760 : 1880018 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_145 1887306 : 1891047 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_146 1894304 : 1896282 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_147 1901303 : 1924747 34 Shigella_phage(23.81%) tRNA,tail,integrase,portal,plate attL 1895349:1895363|attR 1931450:1931464
DBSCAN-SWA_148 1931821 : 1932910 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_149 1941454 : 1943142 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_150 1969811 : 1972563 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_151 1975699 : 1979707 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_152 1982806 : 1983037 1 Spodoptera_litura_granulovirus(100.0%) NA NA
DBSCAN-SWA_153 1994291 : 2004832 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_154 2014242 : 2016257 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_155 2027915 : 2030873 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_156 2037842 : 2043134 4 Chrysochromulina_ericina_virus(33.33%) protease NA
DBSCAN-SWA_157 2048058 : 2048649 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_158 2056466 : 2062123 5 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_159 2075038 : 2076304 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_160 2105564 : 2146382 43 Escherichia_phage(45.16%) lysis,tRNA,tail,integrase,transposase attL 2106711:2106729|attR 2137086:2137104
DBSCAN-SWA_161 2151342 : 2152332 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_162 2177409 : 2179998 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_163 2192549 : 2196452 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_164 2200390 : 2201339 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_165 2213145 : 2223319 10 Escherichia_phage(20.0%) transposase NA
DBSCAN-SWA_166 2230451 : 2232554 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_167 2246797 : 2248342 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_168 2255226 : 2255517 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_169 2261886 : 2263327 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_170 2266600 : 2268506 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_171 2272822 : 2276629 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_172 2281895 : 2288831 3 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_173 2302153 : 2303554 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_174 2310978 : 2312514 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_175 2320395 : 2321343 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_176 2329062 : 2329446 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2332448 : 2333339 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_178 2338703 : 2358152 36 Enterobacteria_phage(39.13%) lysis,tail NA
DBSCAN-SWA_179 2362384 : 2374609 12 Escherichia_phage(57.14%) NA NA
DBSCAN-SWA_180 2392370 : 2393672 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_181 2403748 : 2405560 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_182 2425436 : 2426711 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_183 2433622 : 2435121 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_184 2443923 : 2452731 9 Streptomyces_phage(20.0%) NA NA
DBSCAN-SWA_185 2458235 : 2460502 3 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_186 2468791 : 2473875 5 environmental_halophage(33.33%) NA NA
DBSCAN-SWA_187 2492465 : 2512059 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_188 2523355 : 2525617 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_189 2531946 : 2532774 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_190 2540250 : 2541471 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_191 2548235 : 2548889 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_192 2554487 : 2556449 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2561375 : 2565460 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_194 2574270 : 2575125 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_195 2578443 : 2583020 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_196 2597549 : 2605655 8 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_197 2609517 : 2611074 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_198 2616714 : 2616924 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_199 2622256 : 2624305 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_200 2631801 : 2636271 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_201 2644327 : 2645803 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_202 2649801 : 2656865 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_203 2660883 : 2662934 3 Escherichia_coli_phage(50.0%) NA NA
DBSCAN-SWA_204 2669550 : 2671284 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_205 2676536 : 2682180 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_206 2692267 : 2693782 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_207 2705774 : 2706527 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_208 2718533 : 2719202 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_209 2735035 : 2741792 7 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_210 2746864 : 2747536 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_211 2751080 : 2751611 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_212 2775017 : 2778938 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_213 2785529 : 2785751 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_214 2790093 : 2791260 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_215 2798904 : 2799804 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_216 2807159 : 2824609 15 Escherichia_phage(27.27%) transposase NA
DBSCAN-SWA_217 2830321 : 2837027 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_218 2841270 : 2851661 8 uncultured_marine_virus(20.0%) NA NA
DBSCAN-SWA_219 2856386 : 2857739 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_220 2871588 : 2880110 9 Bacillus_phage(33.33%) transposase,tRNA NA
DBSCAN-SWA_221 2888805 : 2892362 4 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_222 2903010 : 2905044 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_223 2916677 : 2926118 9 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_224 2946479 : 2948000 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_225 2951694 : 2955480 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_226 2959550 : 2960408 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_227 2974955 : 2979256 4 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_228 2985010 : 2992658 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_229 2997775 : 2998792 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_230 3005731 : 3006349 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_231 3015682 : 3021460 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_232 3025737 : 3030580 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_233 3045503 : 3048131 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_234 3053575 : 3059722 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_235 3065614 : 3070125 5 Sodalis_phage(50.0%) transposase NA
DBSCAN-SWA_236 3073728 : 3078732 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_237 3117572 : 3120800 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_238 3131359 : 3133220 2 Sodalis_phage(50.0%) NA NA
DBSCAN-SWA_239 3137431 : 3138949 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_240 3145425 : 3146562 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_241 3155098 : 3156184 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_242 3174011 : 3185221 17 Enterobacteria_phage(50.0%) tail,integrase attL 3171986:3172002|attR 3188896:3188912
DBSCAN-SWA_243 3193084 : 3200661 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_244 3204355 : 3205276 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_245 3209093 : 3209828 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_246 3236751 : 3249405 12 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_247 3252422 : 3253214 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_248 3256692 : 3261812 6 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_249 3267448 : 3268657 1 Enterobacteria_phage(100.0%) integrase attL 3261577:3261590|attR 3271356:3271369
DBSCAN-SWA_250 3287256 : 3288207 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_251 3305495 : 3306209 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_252 3327461 : 3331463 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_253 3337898 : 3344193 6 Escherichia_phage(60.0%) NA NA
DBSCAN-SWA_254 3353023 : 3353455 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_255 3363665 : 3370122 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_256 3385440 : 3386952 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_257 3392844 : 3404134 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_258 3408253 : 3408514 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_259 3411973 : 3415715 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_260 3421486 : 3427745 7 Cafeteria_roenbergensis_virus(25.0%) tRNA NA
DBSCAN-SWA_261 3433038 : 3434337 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_262 3440190 : 3442764 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_263 3448670 : 3449741 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_264 3463486 : 3465991 2 Staphylococcus_phage(50.0%) integrase attL 3459220:3459232|attR 3466705:3466717
DBSCAN-SWA_265 3477255 : 3480745 6 Yersinia_phage(50.0%) NA NA
DBSCAN-SWA_266 3484509 : 3484968 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_267 3491655 : 3491874 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_268 3501325 : 3505377 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_269 3509313 : 3514608 5 Oenococcus_phage(20.0%) NA NA
DBSCAN-SWA_270 3527551 : 3532937 5 Vibrio_phage(25.0%) tRNA NA
DBSCAN-SWA_271 3538403 : 3539369 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_272 3546844 : 3547858 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_273 3565683 : 3578865 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_274 3581977 : 3584010 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_275 3608078 : 3608864 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_276 3613337 : 3618257 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_277 3622289 : 3626404 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_278 3633938 : 3634787 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_279 3639645 : 3640401 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_280 3651927 : 3667475 9 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_281 3672951 : 3679724 6 Geobacillus_virus(33.33%) NA NA
DBSCAN-SWA_282 3689354 : 3691849 2 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_283 3704962 : 3708482 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_284 3732941 : 3748334 14 environmental_Halophage(14.29%) tRNA NA
DBSCAN-SWA_285 3752258 : 3757632 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_286 3765768 : 3767001 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_287 3795296 : 3796451 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 3838768 : 3839785 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_289 3858252 : 3859137 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_290 3865213 : 3874564 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_291 3877874 : 3878267 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_292 3882094 : 3896005 15 Bacillus_virus(16.67%) transposase NA
DBSCAN-SWA_293 3903910 : 3905344 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_294 3910481 : 3911720 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_295 3918120 : 3934316 12 Moraxella_phage(16.67%) tRNA NA
DBSCAN-SWA_296 3947170 : 3948136 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_297 3968714 : 3971009 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_298 3979215 : 3980361 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_299 4001065 : 4008859 10 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_300 4014561 : 4016451 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_301 4021932 : 4028571 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_302 4032653 : 4035526 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_303 4042300 : 4043778 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_304 4047846 : 4062641 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_305 4074292 : 4081165 7 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_306 4084869 : 4085367 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_307 4089333 : 4091858 2 uncultured_Mediterranean_phage(50.0%) protease NA
DBSCAN-SWA_308 4108634 : 4109678 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_309 4120243 : 4121128 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_310 4131026 : 4131785 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_311 4142280 : 4143752 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_312 4164967 : 4166920 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_313 4175750 : 4184309 8 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_314 4189879 : 4199420 9 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_315 4223667 : 4224504 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_316 4241408 : 4245175 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_317 4251757 : 4252636 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_318 4258670 : 4261064 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_319 4265443 : 4266670 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_320 4272725 : 4275173 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_321 4295961 : 4297772 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_322 4301315 : 4302798 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_323 4308520 : 4311339 3 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_324 4314342 : 4318474 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_325 4326367 : 4332019 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_326 4335394 : 4338130 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_327 4351731 : 4353774 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_328 4357119 : 4364494 8 uncultured_Caudovirales_phage(60.0%) transposase NA
DBSCAN-SWA_329 4410455 : 4412440 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_330 4422652 : 4424986 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_331 4428640 : 4430640 3 Morganella_phage(50.0%) transposase NA
DBSCAN-SWA_332 4434478 : 4435474 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_333 4440792 : 4442334 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_334 4466608 : 4474908 4 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_335 4492782 : 4503511 10 Rhizobium_phage(16.67%) NA NA
DBSCAN-SWA_336 4518416 : 4522979 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_337 4526351 : 4533100 6 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_338 4537536 : 4538928 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_339 4551046 : 4552381 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_340 4559687 : 4568708 10 Micromonas_sp._RCC1109_virus(25.0%) NA NA
DBSCAN-SWA_341 4575060 : 4576014 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_342 4580441 : 4581590 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_343 4586296 : 4593665 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_344 4603863 : 4605201 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_345 4616184 : 4623792 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_346 4635746 : 4636739 1 Heterosigma_akashiwo_virus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage