Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045295 Paenibacillus cellulositrophicus strain KACC 16577 chromosome, complete genome 2 crisprs WYL,csa3,DinG,cas3,DEDDh,RT 0 1 4 0
NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 0 crisprs csa3,WYL,cas3 0 0 0 0

Results visualization

1. NZ_CP045295
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045295_1 64316-64397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045295_2 3547878-3548041 Orphan NA
2 spacers
WYL,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045295_1 1.1|64341|32|NZ_CP045295|CRISPRCasFinder 64341-64372 32 MG945651 UNVERIFIED: Microviridae sp. isolate 1160-1602, partial genome 1795-1826 11 0.656

1. spacer 1.1|64341|32|NZ_CP045295|CRISPRCasFinder matches to MG945651 (UNVERIFIED: Microviridae sp. isolate 1160-1602, partial genome) position: , mismatch: 11, identity: 0.656

tggatgcaagaaagcatcatgaggagtgtgtt	CRISPR spacer
aagatgcaagagagcatcatgaagacaaacga	Protospacer
 .*********.**********.**  .    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1182428 : 1191546 10 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 2812864 : 2823983 9 Prochlorococcus_phage(25.0%) NA NA
DBSCAN-SWA_3 3602521 : 3610558 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 5198764 : 5205673 6 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage