Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043061 Bordetella parapertussis strain J859 chromosome, complete genome 7 crisprs RT,csa3,cas3,DEDDh,DinG 0 2 1 0

Results visualization

1. NZ_CP043061
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_1 1052542-1052628 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_2 2469036-2469122 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_3 2770278-2770351 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_4 3081997-3082071 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_5 3767631-3767712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_6 3920656-3920740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043061_7 4131347-4131440 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 376987-377015 3 0.897
NZ_CP043061_3 3.1|2770301|28|NZ_CP043061|CRISPRCasFinder 2770301-2770328 28 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 479490-479517 6 0.786
NZ_CP043061_3 3.1|2770301|28|NZ_CP043061|CRISPRCasFinder 2770301-2770328 28 NZ_CP045303 Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence 2432-2459 6 0.786
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 210180-210208 6 0.793
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1136080-1136108 7 0.759
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 537092-537120 7 0.759
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 812700-812728 7 0.759
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 60621-60649 7 0.759
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 323975-324003 7 0.759
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 18398-18426 8 0.724
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 396287-396315 8 0.724
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 87037-87065 9 0.69
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 48029-48057 9 0.69
NZ_CP043061_4 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder 3082020-3082048 29 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 210011-210039 9 0.69

1. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 3, identity: 0.897

gccccgcaccctgcgccacgc--ccattcgg	CRISPR spacer
gccccgcaccctgcgccacgccgccaatc--	Protospacer
*********************  *** **  

2. spacer 3.1|2770301|28|NZ_CP043061|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 6, identity: 0.786

ataccgtcttggcaggccagcgggacgg	CRISPR spacer
cgaccgtcttggcgggcgagcgggacaa	Protospacer
  ***********.*** ********..

3. spacer 3.1|2770301|28|NZ_CP043061|CRISPRCasFinder matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ataccgtcttggcaggccagcgggacgg	CRISPR spacer
gcccagtcctggcaggccagcgggatgg	Protospacer
.. * ***.****************.**

4. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 6, identity: 0.793

gccccgcaccctgcgccacgcccattcgg-	CRISPR spacer
cgcccgcaccctgcgccaggccc-tccgcc	Protospacer
  **************** **** *.**  

5. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.759

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
gccccgcgccctgcgtcacgcccagcacc	Protospacer
*******.*******.******** .   

6. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
tggccgcacccagcgccacgcccatggcg	Protospacer
   ******** *************   *

7. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.759

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
cgtccgcaccctgcgccacggccagcccg	Protospacer
  .***************** *** .* *

8. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.759

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
ccgccgcaccctgcgccccgaccatttca	Protospacer
 * ************** ** *****. .

9. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.759

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
tgcccgcatcctgcgcaacgcccatctcg	Protospacer
  ******.******* ********.. *

10. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 8, identity: 0.724

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
cgtacgcgccctgcgccacgcccatgtag	Protospacer
  . ***.***************** ..*

11. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.724

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
tccccgcaccctgtgccacgccacgacca	Protospacer
 ************.********    * .

12. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 9, identity: 0.69

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
caaccgcaccctgcgcctcgcccacctca	Protospacer
   ************** ******... .

13. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 9, identity: 0.69

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
caaccgcaccctgcgcctcgcccacctca	Protospacer
   ************** ******... .

14. spacer 4.1|3082020|29|NZ_CP043061|CRISPRCasFinder matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 9, identity: 0.69

gccccgcaccctgcgccacgcccattcgg	CRISPR spacer
caaccgcaccctgcgcctcgcccacctca	Protospacer
   ************** ******... .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1365559 : 1373625 9 Moraxella_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage