Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043120 Bordetella parapertussis strain I139 chromosome, complete genome 7 crisprs RT,csa3,DEDDh,cas3,DinG 1 0 1 0

Results visualization

1. NZ_CP043120
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_1 822591-822747 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_2 1052540-1052626 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_3 2199010-2199096 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_4 3091621-3091717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_5 3767580-3767661 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_6 3920605-3920689 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043120_7 4131304-4131397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP043120_1 1.2|822705|24|NZ_CP043120|PILER-CR 822705-822728 24 NZ_CP043120.1 822567-822590 0 1.0
NZ_CP043120_1 1.2|822705|24|NZ_CP043120|PILER-CR 822705-822728 24 NZ_CP043120.1 822777-822800 0 1.0

1. spacer 1.2|822705|24|NZ_CP043120|PILER-CR matches to position: 822567-822590, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

2. spacer 1.2|822705|24|NZ_CP043120|PILER-CR matches to position: 822777-822800, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3294505 : 3302571 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage