Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043145 Bordetella parapertussis strain H554 chromosome, complete genome 7 crisprs RT,csa3,DEDDh,cas3,DinG 1 0 1 0

Results visualization

1. NZ_CP043145
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_1 822588-822744 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_2 1052536-1052622 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_3 2199038-2199124 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_4 3091617-3091713 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_5 3767569-3767650 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_6 3920593-3920677 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043145_7 4131275-4131368 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP043145_1 1.2|822702|24|NZ_CP043145|PILER-CR 822702-822725 24 NZ_CP043145.1 822564-822587 0 1.0
NZ_CP043145_1 1.2|822702|24|NZ_CP043145|PILER-CR 822702-822725 24 NZ_CP043145.1 822774-822797 0 1.0

1. spacer 1.2|822702|24|NZ_CP043145|PILER-CR matches to position: 822564-822587, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

2. spacer 1.2|822702|24|NZ_CP043145|PILER-CR matches to position: 822774-822797, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3294495 : 3302561 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage